EMAIL THIS PAGE TO A FRIEND

DEFA1

defensin, alpha 1

22 Gene Product Result for
Synonyms: DEF1 DEFA2 HNP-1 HP-1 HP1 MRS
UniProtKB ID: P59665, P11479, Q14125, Q6EZF6
Gene ID:
Human(1667) Summary: Defensins are a family of microbicidal and cytotoxic peptides thought to be involved in host defense. They are abundant in the granules of neutrophils and also found in the epithelia of mucosal surfaces such as those of the intestine, respiratory tract, urinary tract, and vagina. Members of the defensin family are highly similar in protein sequence and distinguished by a conserved cysteine motif. The protein encoded by this gene, defensin, alpha 1, is found in the microbicidal granules of neutrophils and likely plays a role in phagocyte-mediated host defense. Several alpha defensin genes are clustered on chromosome 8. This gene differs from defensin, alpha 3 by only one amino acid. This gene and the gene encoding defensin, alpha 3 are both subject to copy number variation. [provided by RefSeq, May 2010]
Mouse(13216) defensin, alpha 1
Horse(100307002) defensin, alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010031 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010031 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010031 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004084 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004084 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004084 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004084 Rosetta Predictions human pricing
NM_010031 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004084 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200226 predicted 243
2 SASI_Hs01_00200227 predicted 222
3 SASI_Hs01_00200228 predicted 195
4 SASI_Hs01_00200229 predicted 243
5 SASI_Hs01_00200230 predicted 201
6 SASI_Hs01_00200231 predicted 201
7 SASI_Hs01_00200232 predicted 205
8 SASI_Hs01_00200233 predicted 245
9 SASI_Hs01_00200234 predicted 220
10 SASI_Hs01_00200235 predicted 225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010031 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136315 predicted 44
2 SASI_Mm01_00136316 predicted 334
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010031
DEFA1 MISSION shRNA Bacterial Glycerol Stock
defensin, alpha 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010031.2-94s1c1
Sequence:CCGGTCCAGGCTGATTCTATCCAAACTCGAGTTTGGATAGAATCAGCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010031.2-161s1c1
Sequence:CCGGCCAGGCCGTATCTGTCTCCTTCTCGAGAAGGAGACAGATACGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010031.2-271s1c1
Sequence:CCGGGCATGAATGGAACCTGCAGAACTCGAGTTCTGCAGGTTCCATTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010031.2-196s1c1
Sequence:CCGGGCACTTCTCTTCAAGAGGAATCTCGAGATTCCTCTTGAAGAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010031.2-254s1c1
Sequence:CCGGCTGCAAAGGAAGAGAACGCATCTCGAGATGCGTTCTCTTCCTTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010031
DEFA1 MISSION shRNA shRNA Plasmid DNA
defensin, alpha 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010031.2-94s1c1
Sequence:CCGGTCCAGGCTGATTCTATCCAAACTCGAGTTTGGATAGAATCAGCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010031.2-161s1c1
Sequence:CCGGCCAGGCCGTATCTGTCTCCTTCTCGAGAAGGAGACAGATACGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010031.2-271s1c1
Sequence:CCGGGCATGAATGGAACCTGCAGAACTCGAGTTCTGCAGGTTCCATTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010031.2-196s1c1
Sequence:CCGGGCACTTCTCTTCAAGAGGAATCTCGAGATTCCTCTTGAAGAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010031.2-254s1c1
Sequence:CCGGCTGCAAAGGAAGAGAACGCATCTCGAGATGCGTTCTCTTCCTTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010031
DEFA1 MISSION shRNA Lentiviral Transduction Particles
defensin, alpha 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010031.2-94s1c1
Sequence:CCGGTCCAGGCTGATTCTATCCAAACTCGAGTTTGGATAGAATCAGCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010031.2-161s1c1
Sequence:CCGGCCAGGCCGTATCTGTCTCCTTCTCGAGAAGGAGACAGATACGGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010031.2-271s1c1
Sequence:CCGGGCATGAATGGAACCTGCAGAACTCGAGTTCTGCAGGTTCCATTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010031.2-196s1c1
Sequence:CCGGGCACTTCTCTTCAAGAGGAATCTCGAGATTCCTCTTGAAGAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010031.2-254s1c1
Sequence:CCGGCTGCAAAGGAAGAGAACGCATCTCGAGATGCGTTCTCTTCCTTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004084
DEFA1 MISSION shRNA Bacterial Glycerol Stock
defensin, alpha 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004084.2-282s1c1
Sequence:CCGGTGCAGAATACCAGCGTGCATTCTCGAGAATGCACGCTGGTATTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004084.2-178s1c1
Sequence:CCGGCGGAGCAGATTGCAGCGGACACTCGAGTGTCCGCTGCAATCTGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004084.2-269s1c1
Sequence:CCGGCATGGCCTGCTATTGCAGAATCTCGAGATTCTGCAATAGCAGGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004084.2-335s1c1
Sequence:CCGGCCAGGGAAGACTCTGGGCATTCTCGAGAATGCCCAGAGTCTTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004084.2-273s1c1
Sequence:CCGGGCCTGCTATTGCAGAATACCACTCGAGTGGTATTCTGCAATAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004084.2-324s21c1
Sequence:CCGGACCTGCATCTACCAGGGAAGACTCGAGTCTTCCCTGGTAGATGCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004084
DEFA1 MISSION shRNA shRNA Plasmid DNA
defensin, alpha 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004084.2-282s1c1
Sequence:CCGGTGCAGAATACCAGCGTGCATTCTCGAGAATGCACGCTGGTATTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004084.2-178s1c1
Sequence:CCGGCGGAGCAGATTGCAGCGGACACTCGAGTGTCCGCTGCAATCTGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004084.2-269s1c1
Sequence:CCGGCATGGCCTGCTATTGCAGAATCTCGAGATTCTGCAATAGCAGGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004084.2-335s1c1
Sequence:CCGGCCAGGGAAGACTCTGGGCATTCTCGAGAATGCCCAGAGTCTTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004084.2-273s1c1
Sequence:CCGGGCCTGCTATTGCAGAATACCACTCGAGTGGTATTCTGCAATAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004084.2-324s21c1
Sequence:CCGGACCTGCATCTACCAGGGAAGACTCGAGTCTTCCCTGGTAGATGCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004084
DEFA1 MISSION shRNA Lentiviral Transduction Particles
defensin, alpha 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004084.2-282s1c1
Sequence:CCGGTGCAGAATACCAGCGTGCATTCTCGAGAATGCACGCTGGTATTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004084.2-178s1c1
Sequence:CCGGCGGAGCAGATTGCAGCGGACACTCGAGTGTCCGCTGCAATCTGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004084.2-269s1c1
Sequence:CCGGCATGGCCTGCTATTGCAGAATCTCGAGATTCTGCAATAGCAGGCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004084.2-335s1c1
Sequence:CCGGCCAGGGAAGACTCTGGGCATTCTCGAGAATGCCCAGAGTCTTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004084.2-273s1c1
Sequence:CCGGGCCTGCTATTGCAGAATACCACTCGAGTGGTATTCTGCAATAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004084.2-324s21c1
Sequence:CCGGACCTGCATCTACCAGGGAAGACTCGAGTCTTCCCTGGTAGATGCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks