EMAIL THIS PAGE TO A FRIEND

DEFA1B

defensin, alpha 1B

13 Gene Product Result for
Synonyms: HNP-1 HP-1 HP1
Species: Human DEFA1B(728358)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001042500 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001042500 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001042500 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042500 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042500 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310198 predicted 256
2 SASI_Hs02_00310199 predicted 231
3 SASI_Hs02_00310200 predicted 208
4 SASI_Hs02_00310201 predicted 254
5 SASI_Hs02_00310202 predicted 213
6 SASI_Hs02_00310203 predicted 213
7 SASI_Hs02_00310204 predicted 219
8 SASI_Hs02_00310205 predicted 199
9 SASI_Hs02_00310206 predicted 252
10 SASI_Hs02_00310207 predicted 239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042500
DEFA1B MISSION shRNA Bacterial Glycerol Stock
defensin, alpha 1B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042500.1-240s21c1
Sequence:CCGGGACGAAAGCTTGGCTCCAAAGCTCGAGCTTTGGAGCCAAGCTTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042500.1-160s21c1
Sequence:CCGGAGGCAAGAGCTGATGAGGTTGCTCGAGCAACCTCATCAGCTCTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042500.1-313s21c1
Sequence:CCGGTTGCAGGAGAACGTCGCTATGCTCGAGCATAGCGACGTTCTCCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042500.1-209s21c1
Sequence:CCGGCATCCCAGAAGTGGTTGTTTCCTCGAGGAAACAACCACTTCTGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042500.1-280s21c1
Sequence:CCGGACATGGCCTGCTATTGCAGAACTCGAGTTCTGCAATAGCAGGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042500
DEFA1B MISSION shRNA shRNA Plasmid DNA
defensin, alpha 1B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042500.1-240s21c1
Sequence:CCGGGACGAAAGCTTGGCTCCAAAGCTCGAGCTTTGGAGCCAAGCTTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042500.1-160s21c1
Sequence:CCGGAGGCAAGAGCTGATGAGGTTGCTCGAGCAACCTCATCAGCTCTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042500.1-313s21c1
Sequence:CCGGTTGCAGGAGAACGTCGCTATGCTCGAGCATAGCGACGTTCTCCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042500.1-209s21c1
Sequence:CCGGCATCCCAGAAGTGGTTGTTTCCTCGAGGAAACAACCACTTCTGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042500.1-280s21c1
Sequence:CCGGACATGGCCTGCTATTGCAGAACTCGAGTTCTGCAATAGCAGGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042500
DEFA1B MISSION shRNA Lentiviral Transduction Particles
defensin, alpha 1B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042500.1-240s21c1
Sequence:CCGGGACGAAAGCTTGGCTCCAAAGCTCGAGCTTTGGAGCCAAGCTTTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042500.1-160s21c1
Sequence:CCGGAGGCAAGAGCTGATGAGGTTGCTCGAGCAACCTCATCAGCTCTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042500.1-313s21c1
Sequence:CCGGTTGCAGGAGAACGTCGCTATGCTCGAGCATAGCGACGTTCTCCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042500.1-209s21c1
Sequence:CCGGCATCCCAGAAGTGGTTGTTTCCTCGAGGAAACAACCACTTCTGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042500.1-280s21c1
Sequence:CCGGACATGGCCTGCTATTGCAGAACTCGAGTTCTGCAATAGCAGGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks