EMAIL THIS PAGE TO A FRIEND

DEFA3

defensin, alpha 3, neutrophil-specific

16 Gene Product Result for
Synonyms: DEF3 HNP-3 HNP3 HP-3 HP3
UniProtKB ID: P59666, P11479, Q14125
Gene ID:
Human(1668) Summary: Defensins are a family of microbicidal and cytotoxic peptides thought to be involved in host defense. They are abundant in the granules of neutrophils and also found in the epithelia of mucosal surfaces such as those of the intestine, respiratory tract, urinary tract, and vagina. Members of the defensin family are highly similar in protein sequence and distinguished by a conserved cysteine motif. The protein encoded by this gene, defensin, alpha 3, is found in the microbicidal granules of neutrophils and likely plays a role in phagocyte-mediated host defense. Several alpha defensin genes are clustered on chromosome 8. This gene differs from defensin, alpha 1 by only one amino acid. This gene and the gene encoding defensin, alpha 1 are both subject to copy number variation. [provided by RefSeq, May 2010]
Mouse(13237) defensin, alpha, 3
Horse(100307025) defensin, alpha 3, neutrophil-specific
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305860 ANTI-DEFA3(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005217 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005217 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005217 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007850 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007850 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007850 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005217 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005217 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104151 predicted 251
2 SASI_Hs01_00104152 predicted 228
3 SASI_Hs01_00104153 predicted 203
4 SASI_Hs01_00104154 predicted 251
5 SASI_Hs01_00104155 predicted 207
6 SASI_Hs01_00104156 predicted 203
7 SASI_Hs01_00104157 predicted 208
8 SASI_Hs01_00104158 predicted 230
9 SASI_Hs02_00339203 predicted 197
10 SASI_Hs01_00104159 predicted 232
11 SASI_Hs01_00104160 predicted 355
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005217
DEFA3 MISSION shRNA Bacterial Glycerol Stock
defensin, alpha 3, neutrophil-specific
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005217.2-220s21c1
Sequence:CCGGTTCCCTTGCATGGGACGAAAGCTCGAGCTTTCGTCCCATGCAAGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005217.2-249s21c1
Sequence:CCGGCAAAGCATCCAGGCTCAAGGACTCGAGTCCTTGAGCCTGGATGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005217.2-206s1c1
Sequence:CCGGCCAGAAGTGGTTGTTTCCCTTCTCGAGAAGGGAAACAACCACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005217.2-274s1c1
Sequence:CCGGCATGGACTGCTATTGCAGAATCTCGAGATTCTGCAATAGCAGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005217.2-319s1c1
Sequence:CCGGTCGCTATGGAACCTGCATCTACTCGAGTAGATGCAGGTTCCATAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005217.2-201s1c1
Sequence:CCGGACATCCCAGAAGTGGTTGTTTCTCGAGAAACAACCACTTCTGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005217.2-296s1c1
Sequence:CCGGCCAGCGTGCATTGCAGGAGAACTCGAGTTCTCCTGCAATGCACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005217
DEFA3 MISSION shRNA shRNA Plasmid DNA
defensin, alpha 3, neutrophil-specific
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005217.2-220s21c1
Sequence:CCGGTTCCCTTGCATGGGACGAAAGCTCGAGCTTTCGTCCCATGCAAGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005217.2-249s21c1
Sequence:CCGGCAAAGCATCCAGGCTCAAGGACTCGAGTCCTTGAGCCTGGATGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005217.2-206s1c1
Sequence:CCGGCCAGAAGTGGTTGTTTCCCTTCTCGAGAAGGGAAACAACCACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005217.2-274s1c1
Sequence:CCGGCATGGACTGCTATTGCAGAATCTCGAGATTCTGCAATAGCAGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005217.2-319s1c1
Sequence:CCGGTCGCTATGGAACCTGCATCTACTCGAGTAGATGCAGGTTCCATAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005217.2-201s1c1
Sequence:CCGGACATCCCAGAAGTGGTTGTTTCTCGAGAAACAACCACTTCTGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005217.2-296s1c1
Sequence:CCGGCCAGCGTGCATTGCAGGAGAACTCGAGTTCTCCTGCAATGCACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005217
DEFA3 MISSION shRNA Lentiviral Transduction Particles
defensin, alpha 3, neutrophil-specific
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005217.2-220s21c1
Sequence:CCGGTTCCCTTGCATGGGACGAAAGCTCGAGCTTTCGTCCCATGCAAGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005217.2-249s21c1
Sequence:CCGGCAAAGCATCCAGGCTCAAGGACTCGAGTCCTTGAGCCTGGATGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005217.2-206s1c1
Sequence:CCGGCCAGAAGTGGTTGTTTCCCTTCTCGAGAAGGGAAACAACCACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005217.2-274s1c1
Sequence:CCGGCATGGACTGCTATTGCAGAATCTCGAGATTCTGCAATAGCAGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005217.2-319s1c1
Sequence:CCGGTCGCTATGGAACCTGCATCTACTCGAGTAGATGCAGGTTCCATAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005217.2-201s1c1
Sequence:CCGGACATCCCAGAAGTGGTTGTTTCTCGAGAAACAACCACTTCTGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005217.2-296s1c1
Sequence:CCGGCCAGCGTGCATTGCAGGAGAACTCGAGTTCTCCTGCAATGCACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007850
DEFA3 MISSION shRNA Bacterial Glycerol Stock
defensin, alpha 3, neutrophil-specific
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007850.1-237s21c1
Sequence:CCGGGACCTGCAGAAAGGGTCATTTCTCGAGAAATGACCCTTTCTGCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007850.1-248s21c1
Sequence:CCGGAGGGTCATTTAATGTACACACCTCGAGGTGTGTACATTAAATGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007850.1-142s21c1
Sequence:CCGGGACCCAGAAGGCTCTTCTCTTCTCGAGAAGAGAAGAGCCTTCTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007850.1-176s21c1
Sequence:CCGGTGAGAGATCTGGTATGCTATTCTCGAGAATAGCATACCAGATCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007850.1-158s21c1
Sequence:CCGGCTCTTCAAGAGGAATCGTTGACTCGAGTCAACGATTCCTCTTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007850
DEFA3 MISSION shRNA shRNA Plasmid DNA
defensin, alpha 3, neutrophil-specific
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007850.1-237s21c1
Sequence:CCGGGACCTGCAGAAAGGGTCATTTCTCGAGAAATGACCCTTTCTGCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007850.1-248s21c1
Sequence:CCGGAGGGTCATTTAATGTACACACCTCGAGGTGTGTACATTAAATGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007850.1-142s21c1
Sequence:CCGGGACCCAGAAGGCTCTTCTCTTCTCGAGAAGAGAAGAGCCTTCTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007850.1-176s21c1
Sequence:CCGGTGAGAGATCTGGTATGCTATTCTCGAGAATAGCATACCAGATCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007850.1-158s21c1
Sequence:CCGGCTCTTCAAGAGGAATCGTTGACTCGAGTCAACGATTCCTCTTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007850
DEFA3 MISSION shRNA Lentiviral Transduction Particles
defensin, alpha 3, neutrophil-specific
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007850.1-237s21c1
Sequence:CCGGGACCTGCAGAAAGGGTCATTTCTCGAGAAATGACCCTTTCTGCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007850.1-248s21c1
Sequence:CCGGAGGGTCATTTAATGTACACACCTCGAGGTGTGTACATTAAATGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007850.1-142s21c1
Sequence:CCGGGACCCAGAAGGCTCTTCTCTTCTCGAGAAGAGAAGAGCCTTCTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007850.1-176s21c1
Sequence:CCGGTGAGAGATCTGGTATGCTATTCTCGAGAATAGCATACCAGATCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007850.1-158s21c1
Sequence:CCGGCTCTTCAAGAGGAATCGTTGACTCGAGTCAACGATTCCTCTTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks