EMAIL THIS PAGE TO A FRIEND

DEFA4

defensin, alpha 4, corticostatin

33 Gene Product Result for
Synonyms: DEF4 HNP-4 HP-4 HP4
UniProtKB ID: P12838
Gene ID:
Human(1669) Summary: Defensins are a family of microbicidal and cytotoxic peptides thought to be involved in host defense. They are abundant in the granules of neutrophils and also found in the epithelia of mucosal surfaces such as those of the intestine, respiratory tract, urinary tract, and vagina. Members of the defensin family are highly similar in protein sequence and distinguished by a conserved cysteine motif. Several alpha defensin genes are clustered on chromosome 8. This gene differs from other genes of this family by an extra 83-base segment that is apparently the result of a recent duplication within the coding region. The protein encoded by this gene, defensin, alpha 4, is found in the neutrophils; it exhibits corticostatic activity and inhibits corticotropin stimulated corticosterone production. [provided by RefSeq, Jul 2008]
Mouse(13238) defensin, alpha, 4
Horse(100307026) defensin, alpha 4, corticostatin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001925 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001925 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001925 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010039 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010039 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010039 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU058061 MISSION® esiRNA esiRNA human DEFA4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001925 Rosetta Predictions human pricing
NM_010039 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001925 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191586 predicted 233
2 SASI_Hs01_00191587 predicted 290
3 SASI_Hs01_00191588 predicted 294
4 SASI_Hs01_00191589 predicted 295
5 SASI_Hs02_00332818 predicted 303
6 SASI_Hs02_00332819 predicted 229
7 SASI_Hs01_00191590 predicted 260
8 SASI_Hs01_00191591 predicted 200
9 SASI_Hs01_00191592 predicted 282
10 SASI_Hs01_00191593 predicted 280
11 SASI_Hs01_00191594 predicted 303
12 SASI_Hs01_00191595 predicted 239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010039 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110727 predicted 229
2 SASI_Mm01_00110728 predicted 220
3 SASI_Mm01_00110729 predicted 235
4 SASI_Mm01_00110730 predicted 178
5 SASI_Mm01_00110731 predicted 227
6 SASI_Mm01_00110732 predicted 234
7 SASI_Mm01_00110733 predicted 173
8 SASI_Mm01_00110734 predicted 171
9 SASI_Mm01_00110735 predicted 170
10 SASI_Mm01_00110736 predicted 179
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001925
DEFA4 MISSION shRNA Bacterial Glycerol Stock
defensin, alpha 4, corticostatin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001925.1-388s1c1
Sequence:CCGGTCGGTGGTGTTAGCTTCACATCTCGAGATGTGAAGCTAACACCACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001925.1-168s1c1
Sequence:CCGGCCAGGACATATCTATTTCCTTCTCGAGAAGGAAATAGATATGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001925.1-209s1c1
Sequence:CCGGCTCTTCAGGTTTCAGGCTCAACTCGAGTTGAGCCTGAAACCTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001925.1-296s1c1
Sequence:CCGGGCCTCATTGGTGGTGTGAGTTCTCGAGAACTCACACCACCAATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001925.1-346s1c1
Sequence:CCGGCGTTCTGCTGTCCAAGAGAATCTCGAGATTCTCTTGGACAGCAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001925.1-268s21c1
Sequence:CCGGCGGCGAACAGAACTTCGTGTTCTCGAGAACACGAAGTTCTGTTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001925.1-324s21c1
Sequence:CCGGCTGCTGCACGCGTGTCGATTACTCGAGTAATCGACACGCGTGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001925.1-243s21c1
Sequence:CCGGCTGCTCTTGCAGATTAGTATTCTCGAGAATACTAATCTGCAAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001925
DEFA4 MISSION shRNA shRNA Plasmid DNA
defensin, alpha 4, corticostatin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001925.1-388s1c1
Sequence:CCGGTCGGTGGTGTTAGCTTCACATCTCGAGATGTGAAGCTAACACCACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001925.1-168s1c1
Sequence:CCGGCCAGGACATATCTATTTCCTTCTCGAGAAGGAAATAGATATGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001925.1-209s1c1
Sequence:CCGGCTCTTCAGGTTTCAGGCTCAACTCGAGTTGAGCCTGAAACCTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001925.1-296s1c1
Sequence:CCGGGCCTCATTGGTGGTGTGAGTTCTCGAGAACTCACACCACCAATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001925.1-346s1c1
Sequence:CCGGCGTTCTGCTGTCCAAGAGAATCTCGAGATTCTCTTGGACAGCAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001925.1-268s21c1
Sequence:CCGGCGGCGAACAGAACTTCGTGTTCTCGAGAACACGAAGTTCTGTTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001925.1-324s21c1
Sequence:CCGGCTGCTGCACGCGTGTCGATTACTCGAGTAATCGACACGCGTGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001925.1-243s21c1
Sequence:CCGGCTGCTCTTGCAGATTAGTATTCTCGAGAATACTAATCTGCAAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001925
DEFA4 MISSION shRNA Lentiviral Transduction Particles
defensin, alpha 4, corticostatin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001925.1-388s1c1
Sequence:CCGGTCGGTGGTGTTAGCTTCACATCTCGAGATGTGAAGCTAACACCACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001925.1-168s1c1
Sequence:CCGGCCAGGACATATCTATTTCCTTCTCGAGAAGGAAATAGATATGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001925.1-209s1c1
Sequence:CCGGCTCTTCAGGTTTCAGGCTCAACTCGAGTTGAGCCTGAAACCTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001925.1-296s1c1
Sequence:CCGGGCCTCATTGGTGGTGTGAGTTCTCGAGAACTCACACCACCAATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001925.1-346s1c1
Sequence:CCGGCGTTCTGCTGTCCAAGAGAATCTCGAGATTCTCTTGGACAGCAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001925.1-268s21c1
Sequence:CCGGCGGCGAACAGAACTTCGTGTTCTCGAGAACACGAAGTTCTGTTCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001925.1-324s21c1
Sequence:CCGGCTGCTGCACGCGTGTCGATTACTCGAGTAATCGACACGCGTGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001925.1-243s21c1
Sequence:CCGGCTGCTCTTGCAGATTAGTATTCTCGAGAATACTAATCTGCAAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010039
DEFA4 MISSION shRNA Bacterial Glycerol Stock
defensin, alpha 4, corticostatin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010039.1-45s1c1
Sequence:CCGGCCAGGTCCAGGCTGATCCTATCTCGAGATAGGATCAGCCTGGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010039.1-129s1c1
Sequence:CCGGTATCTCCTTTGGAGGCCAAGACTCGAGTCTTGGCCTCCAAAGGAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010039.1-118s1c1
Sequence:CCGGCAGGCTGTGTCTATCTCCTTTCTCGAGAAAGGAGATAGACACAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010039.1-49s1c1
Sequence:CCGGGTCCAGGCTGATCCTATCCAACTCGAGTTGGATAGGATCAGCCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010039.1-109s1c1
Sequence:CCGGGAAGAGGACCAGGCTGTGTCTCTCGAGAGACACAGCCTGGTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010039
DEFA4 MISSION shRNA shRNA Plasmid DNA
defensin, alpha 4, corticostatin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010039.1-45s1c1
Sequence:CCGGCCAGGTCCAGGCTGATCCTATCTCGAGATAGGATCAGCCTGGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010039.1-129s1c1
Sequence:CCGGTATCTCCTTTGGAGGCCAAGACTCGAGTCTTGGCCTCCAAAGGAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010039.1-118s1c1
Sequence:CCGGCAGGCTGTGTCTATCTCCTTTCTCGAGAAAGGAGATAGACACAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010039.1-49s1c1
Sequence:CCGGGTCCAGGCTGATCCTATCCAACTCGAGTTGGATAGGATCAGCCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010039.1-109s1c1
Sequence:CCGGGAAGAGGACCAGGCTGTGTCTCTCGAGAGACACAGCCTGGTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010039
DEFA4 MISSION shRNA Lentiviral Transduction Particles
defensin, alpha 4, corticostatin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010039.1-45s1c1
Sequence:CCGGCCAGGTCCAGGCTGATCCTATCTCGAGATAGGATCAGCCTGGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010039.1-129s1c1
Sequence:CCGGTATCTCCTTTGGAGGCCAAGACTCGAGTCTTGGCCTCCAAAGGAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010039.1-118s1c1
Sequence:CCGGCAGGCTGTGTCTATCTCCTTTCTCGAGAAAGGAGATAGACACAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010039.1-49s1c1
Sequence:CCGGGTCCAGGCTGATCCTATCCAACTCGAGTTGGATAGGATCAGCCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010039.1-109s1c1
Sequence:CCGGGAAGAGGACCAGGCTGTGTCTCTCGAGAGACACAGCCTGGTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks