EMAIL THIS PAGE TO A FRIEND

DEFA5

defensin, alpha 5, Paneth cell-specific

41 Gene Product Result for
Synonyms: DEF5 HD-5
UniProtKB ID: Q01523, A0JDY6, Q3KNV2
Gene ID:
Human(1670) Summary: Defensins are a family of microbicidal and cytotoxic peptides thought to be involved in host defense. They are abundant in the granules of neutrophils and also found in the epithelia of mucosal surfaces such as those of the intestine, respiratory tract, urinary tract, and vagina. Members of the defensin family are highly similar in protein sequence and distinguished by a conserved cysteine motif. Several of the alpha defensin genes appear to be clustered on chromosome 8. The protein encoded by this gene, defensin, alpha 5, is highly expressed in the secretory granules of Paneth cells of the ileum. [provided by RefSeq, Jul 2008]
Mouse(13239) defensin, alpha, 5
Rat(286995) defensin, alpha 5, Paneth cell-specific
Horse(100307028) defensin, alpha 5, Paneth cell-specific
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021010 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021010 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021010 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007851 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007851 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007851 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU057841 MISSION® esiRNA esiRNA human DEFA5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021010 Rosetta Predictions human pricing
NM_173329 Rosetta Predictions rat pricing
NM_007851 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021010 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146733 predicted 209
2 SASI_Hs01_00146737 predicted 218
3 SASI_Hs01_00146732 predicted 202
4 SASI_Hs01_00146734 predicted 207
5 SASI_Hs01_00146735 predicted 204
6 SASI_Hs01_00146738 predicted 391
7 SASI_Hs01_00146739 predicted 162
8 SASI_Hs01_00146740 predicted 390
9 SASI_Hs01_00146741 predicted 342
10 SASI_Hs02_00354483 predicted 313
11 SASI_Hs01_00146736 predicted 226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173329 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112393 predicted 266
2 SASI_Rn01_00112394 predicted 387
3 SASI_Rn01_00112395 predicted 416
4 SASI_Rn01_00112396 predicted 407
5 SASI_Rn01_00112397 predicted 404
6 SASI_Rn01_00112398 predicted 405
7 SASI_Rn02_00269451 predicted 391
8 SASI_Rn01_00112399 predicted 321
9 SASI_Rn01_00112400 predicted 412
10 SASI_Rn01_00112401 predicted 332
11 SASI_Rn01_00112402 predicted 325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007851 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312619 predicted 304
2 SASI_Mm01_00046699 predicted 272
3 SASI_Mm01_00046697 predicted 57
4 SASI_Mm01_00046698 predicted 157
5 SASI_Mm01_00046700 predicted 153
6 SASI_Mm01_00046701 predicted 153
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021010
DEFA5 MISSION shRNA Bacterial Glycerol Stock
defensin, alpha 5, Paneth cell-specific
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021010.1-219s21c1
Sequence:CCGGAGGCAAGAGCCACCTGCTATTCTCGAGAATAGCAGGTGGCTCTTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021010.1-110s21c1
Sequence:CCGGGAAAGAGCTGATGAGGCTACACTCGAGTGTAGCCTCATCAGCTCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021010.1-206s21c1
Sequence:CCGGACCTCAGGTTCTCAGGCAAGACTCGAGTCTTGCCTGAGAACCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021010.1-158s1c1
Sequence:CCGGCAGGACCTTGCTATCTCCTTTCTCGAGAAAGGAGATAGCAAGGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021010.1-297s1c1
Sequence:CCGGGCCGCCTCTACAGACTCTGCTCTCGAGAGCAGAGTCTGTAGAGGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021010.1-167s1c1
Sequence:CCGGGCTATCTCCTTTGCAGGAAATCTCGAGATTTCCTGCAAAGGAGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021010.1-183s1c1
Sequence:CCGGGAAATGGACTCTCTGCTCTTACTCGAGTAAGAGCAGAGAGTCCATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021010.1-195s1c1
Sequence:CCGGCTGCTCTTAGAACCTCAGGTTCTCGAGAACCTGAGGTTCTAAGAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021010
DEFA5 MISSION shRNA shRNA Plasmid DNA
defensin, alpha 5, Paneth cell-specific
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021010.1-219s21c1
Sequence:CCGGAGGCAAGAGCCACCTGCTATTCTCGAGAATAGCAGGTGGCTCTTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021010.1-110s21c1
Sequence:CCGGGAAAGAGCTGATGAGGCTACACTCGAGTGTAGCCTCATCAGCTCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021010.1-206s21c1
Sequence:CCGGACCTCAGGTTCTCAGGCAAGACTCGAGTCTTGCCTGAGAACCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021010.1-158s1c1
Sequence:CCGGCAGGACCTTGCTATCTCCTTTCTCGAGAAAGGAGATAGCAAGGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021010.1-297s1c1
Sequence:CCGGGCCGCCTCTACAGACTCTGCTCTCGAGAGCAGAGTCTGTAGAGGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021010.1-167s1c1
Sequence:CCGGGCTATCTCCTTTGCAGGAAATCTCGAGATTTCCTGCAAAGGAGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021010.1-183s1c1
Sequence:CCGGGAAATGGACTCTCTGCTCTTACTCGAGTAAGAGCAGAGAGTCCATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021010.1-195s1c1
Sequence:CCGGCTGCTCTTAGAACCTCAGGTTCTCGAGAACCTGAGGTTCTAAGAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021010
DEFA5 MISSION shRNA Lentiviral Transduction Particles
defensin, alpha 5, Paneth cell-specific
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021010.1-219s21c1
Sequence:CCGGAGGCAAGAGCCACCTGCTATTCTCGAGAATAGCAGGTGGCTCTTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021010.1-110s21c1
Sequence:CCGGGAAAGAGCTGATGAGGCTACACTCGAGTGTAGCCTCATCAGCTCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021010.1-206s21c1
Sequence:CCGGACCTCAGGTTCTCAGGCAAGACTCGAGTCTTGCCTGAGAACCTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021010.1-158s1c1
Sequence:CCGGCAGGACCTTGCTATCTCCTTTCTCGAGAAAGGAGATAGCAAGGTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021010.1-297s1c1
Sequence:CCGGGCCGCCTCTACAGACTCTGCTCTCGAGAGCAGAGTCTGTAGAGGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021010.1-167s1c1
Sequence:CCGGGCTATCTCCTTTGCAGGAAATCTCGAGATTTCCTGCAAAGGAGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021010.1-183s1c1
Sequence:CCGGGAAATGGACTCTCTGCTCTTACTCGAGTAAGAGCAGAGAGTCCATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021010.1-195s1c1
Sequence:CCGGCTGCTCTTAGAACCTCAGGTTCTCGAGAACCTGAGGTTCTAAGAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007851
DEFA5 MISSION shRNA Bacterial Glycerol Stock
defensin, alpha 5, Paneth cell-specific
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007851.1-121s1c1
Sequence:CCGGGCTGTGTCTATCTCCTTTGGACTCGAGTCCAAAGGAGATAGACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007851.1-127s1c1
Sequence:CCGGTCTATCTCCTTTGGAGGCCAACTCGAGTTGGCCTCCAAAGGAGATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007851.1-117s1c1
Sequence:CCGGCCAGGCTGTGTCTATCTCCTTCTCGAGAAGGAGATAGACACAGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007851.1-40s1c1
Sequence:CCGGGCCTTCCAGGTCCAGGCTGATCTCGAGATCAGCCTGGACCTGGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007851.1-52s1c1
Sequence:CCGGCAGGCTGATCCTATCCACAAACTCGAGTTTGTGGATAGGATCAGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000455066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007851.2-118s21c1
Sequence:CCGGACAGATGAAGAGACTAATACTCTCGAGAGTATTAGTCTCTTCATCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007851
DEFA5 MISSION shRNA shRNA Plasmid DNA
defensin, alpha 5, Paneth cell-specific
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007851.1-121s1c1
Sequence:CCGGGCTGTGTCTATCTCCTTTGGACTCGAGTCCAAAGGAGATAGACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007851.1-127s1c1
Sequence:CCGGTCTATCTCCTTTGGAGGCCAACTCGAGTTGGCCTCCAAAGGAGATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007851.1-117s1c1
Sequence:CCGGCCAGGCTGTGTCTATCTCCTTCTCGAGAAGGAGATAGACACAGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007851.1-40s1c1
Sequence:CCGGGCCTTCCAGGTCCAGGCTGATCTCGAGATCAGCCTGGACCTGGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007851.1-52s1c1
Sequence:CCGGCAGGCTGATCCTATCCACAAACTCGAGTTTGTGGATAGGATCAGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000455066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007851.2-118s21c1
Sequence:CCGGACAGATGAAGAGACTAATACTCTCGAGAGTATTAGTCTCTTCATCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007851
DEFA5 MISSION shRNA Lentiviral Transduction Particles
defensin, alpha 5, Paneth cell-specific
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007851.1-121s1c1
Sequence:CCGGGCTGTGTCTATCTCCTTTGGACTCGAGTCCAAAGGAGATAGACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007851.1-127s1c1
Sequence:CCGGTCTATCTCCTTTGGAGGCCAACTCGAGTTGGCCTCCAAAGGAGATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007851.1-117s1c1
Sequence:CCGGCCAGGCTGTGTCTATCTCCTTCTCGAGAAGGAGATAGACACAGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007851.1-40s1c1
Sequence:CCGGGCCTTCCAGGTCCAGGCTGATCTCGAGATCAGCCTGGACCTGGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007851.1-52s1c1
Sequence:CCGGCAGGCTGATCCTATCCACAAACTCGAGTTTGTGGATAGGATCAGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000455066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007851.2-118s21c1
Sequence:CCGGACAGATGAAGAGACTAATACTCTCGAGAGTATTAGTCTCTTCATCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)