EMAIL THIS PAGE TO A FRIEND

DEFA6

defensin, alpha 6, Paneth cell-specific

33 Gene Product Result for
Synonyms: DEF6 HD-6
UniProtKB ID: Q01524
Gene ID:
Human(1671) Summary: Defensins are a family of microbicidal and cytotoxic peptides thought to be involved in host defense. They are abundant in the granules of neutrophils and also found in the epithelia of mucosal surfaces such as those of the intestine, respiratory tract, urinary tract, and vagina. Members of the defensin family are highly similar in protein sequence and distinguished by a conserved cysteine motif. Several alpha defensin genes appear to be clustered on chromosome 8. The protein encoded by this gene, defensin, alpha 6, is highly expressed in the secretory granules of Paneth cells of the small intestine, and likely plays a role in host defense of human bowel. [provided by RefSeq, Jul 2008]
Mouse(13240) defensin, alpha, 6
Rat(613223) defensin alpha 6
Horse(100307029) defensin, alpha 6, Paneth cell-specific
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001926 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001926 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001926 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007852 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007852 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007852 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155881 MISSION® esiRNA esiRNA human DEFA6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001926 Rosetta Predictions human pricing
NM_001033076 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001926 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231350 predicted 205
2 SASI_Hs01_00231351 predicted 208
3 SASI_Hs01_00231352 predicted 209
4 SASI_Hs01_00231354 predicted 202
5 SASI_Hs01_00231355 predicted 216
6 SASI_Hs01_00231356 predicted 240
7 SASI_Hs01_00231357 predicted 208
8 SASI_Hs01_00231358 predicted 221
9 SASI_Hs02_00332820 predicted 216
10 SASI_Hs01_00231349 predicted 236
11 SASI_Hs01_00231353 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033076 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088223 predicted 212
2 SASI_Rn01_00088224 predicted 256
3 SASI_Rn01_00088225 predicted 198
4 SASI_Rn01_00088226 predicted 188
5 SASI_Rn01_00088227 predicted 182
6 SASI_Rn01_00088228 predicted 97
7 SASI_Rn01_00088229 predicted 182
8 SASI_Rn01_00088230 predicted 201
9 SASI_Rn02_00203643 predicted 20
10 SASI_Rn01_00088222 predicted 148
11 SASI_Rn01_00088231 predicted 144
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001926
DEFA6 MISSION shRNA Bacterial Glycerol Stock
defensin, alpha 6, Paneth cell-specific
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001926.2-311s1c1
Sequence:CCGGCATGGGTATTAACCACAGATTCTCGAGAATCTGTGGTTAATACCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001926.2-211s1c1
Sequence:CCGGCAAGCTCAAGTCTTAGAGCTTCTCGAGAAGCTCTAAGACTTGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001926.2-302s1c1
Sequence:CCGGCTGCACTGTCATGGGTATTAACTCGAGTTAATACCCATGACAGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001926.2-269s1c1
Sequence:CCGGGTCCTGTTATTCAACAGAATACTCGAGTATTCTGTTGAATAACAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001926.2-241s1c1
Sequence:CCGGCAAGGGCTTTCACTTGCCATTCTCGAGAATGGCAAGTGAAAGCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001926.2-106s21c1
Sequence:CCGGTCCAAGCTGAGGATGATCCACCTCGAGGTGGATCATCCTCAGCTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001926.2-223s21c1
Sequence:CCGGTTAGAGCTTTGGGCTCAACAACTCGAGTTGTTGAGCCCAAAGCTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001926.2-169s21c1
Sequence:CCGGGGGCAAATGACCAGGACTTTGCTCGAGCAAAGTCCTGGTCATTTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001926
DEFA6 MISSION shRNA shRNA Plasmid DNA
defensin, alpha 6, Paneth cell-specific
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001926.2-311s1c1
Sequence:CCGGCATGGGTATTAACCACAGATTCTCGAGAATCTGTGGTTAATACCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001926.2-211s1c1
Sequence:CCGGCAAGCTCAAGTCTTAGAGCTTCTCGAGAAGCTCTAAGACTTGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001926.2-302s1c1
Sequence:CCGGCTGCACTGTCATGGGTATTAACTCGAGTTAATACCCATGACAGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001926.2-269s1c1
Sequence:CCGGGTCCTGTTATTCAACAGAATACTCGAGTATTCTGTTGAATAACAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001926.2-241s1c1
Sequence:CCGGCAAGGGCTTTCACTTGCCATTCTCGAGAATGGCAAGTGAAAGCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001926.2-106s21c1
Sequence:CCGGTCCAAGCTGAGGATGATCCACCTCGAGGTGGATCATCCTCAGCTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001926.2-223s21c1
Sequence:CCGGTTAGAGCTTTGGGCTCAACAACTCGAGTTGTTGAGCCCAAAGCTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001926.2-169s21c1
Sequence:CCGGGGGCAAATGACCAGGACTTTGCTCGAGCAAAGTCCTGGTCATTTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001926
DEFA6 MISSION shRNA Lentiviral Transduction Particles
defensin, alpha 6, Paneth cell-specific
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001926.2-311s1c1
Sequence:CCGGCATGGGTATTAACCACAGATTCTCGAGAATCTGTGGTTAATACCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001926.2-211s1c1
Sequence:CCGGCAAGCTCAAGTCTTAGAGCTTCTCGAGAAGCTCTAAGACTTGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001926.2-302s1c1
Sequence:CCGGCTGCACTGTCATGGGTATTAACTCGAGTTAATACCCATGACAGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001926.2-269s1c1
Sequence:CCGGGTCCTGTTATTCAACAGAATACTCGAGTATTCTGTTGAATAACAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001926.2-241s1c1
Sequence:CCGGCAAGGGCTTTCACTTGCCATTCTCGAGAATGGCAAGTGAAAGCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001926.2-106s21c1
Sequence:CCGGTCCAAGCTGAGGATGATCCACCTCGAGGTGGATCATCCTCAGCTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001926.2-223s21c1
Sequence:CCGGTTAGAGCTTTGGGCTCAACAACTCGAGTTGTTGAGCCCAAAGCTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001926.2-169s21c1
Sequence:CCGGGGGCAAATGACCAGGACTTTGCTCGAGCAAAGTCCTGGTCATTTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007852
DEFA6 MISSION shRNA Bacterial Glycerol Stock
defensin, alpha 6, Paneth cell-specific
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007852.1-117s1c1
Sequence:CCGGCCAGGCTGTGTCTGTCTCTTTCTCGAGAAAGAGACAGACACAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007852.1-44s1c1
Sequence:CCGGTCCAGGTCCAGGCTGATCCTACTCGAGTAGGATCAGCCTGGACCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007852.1-115s1c1
Sequence:CCGGGACCAGGCTGTGTCTGTCTCTCTCGAGAGAGACAGACACAGCCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007852.1-116s1c1
Sequence:CCGGACCAGGCTGTGTCTGTCTCTTCTCGAGAAGAGACAGACACAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007852.1-37s1c1
Sequence:CCGGCTGGCCTTCCAGGTCCAGGCTCTCGAGAGCCTGGACCTGGAAGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007852
DEFA6 MISSION shRNA shRNA Plasmid DNA
defensin, alpha 6, Paneth cell-specific
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007852.1-117s1c1
Sequence:CCGGCCAGGCTGTGTCTGTCTCTTTCTCGAGAAAGAGACAGACACAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007852.1-44s1c1
Sequence:CCGGTCCAGGTCCAGGCTGATCCTACTCGAGTAGGATCAGCCTGGACCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007852.1-115s1c1
Sequence:CCGGGACCAGGCTGTGTCTGTCTCTCTCGAGAGAGACAGACACAGCCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007852.1-116s1c1
Sequence:CCGGACCAGGCTGTGTCTGTCTCTTCTCGAGAAGAGACAGACACAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007852.1-37s1c1
Sequence:CCGGCTGGCCTTCCAGGTCCAGGCTCTCGAGAGCCTGGACCTGGAAGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007852
DEFA6 MISSION shRNA Lentiviral Transduction Particles
defensin, alpha 6, Paneth cell-specific
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007852.1-117s1c1
Sequence:CCGGCCAGGCTGTGTCTGTCTCTTTCTCGAGAAAGAGACAGACACAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007852.1-44s1c1
Sequence:CCGGTCCAGGTCCAGGCTGATCCTACTCGAGTAGGATCAGCCTGGACCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007852.1-115s1c1
Sequence:CCGGGACCAGGCTGTGTCTGTCTCTCTCGAGAGAGACAGACACAGCCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007852.1-116s1c1
Sequence:CCGGACCAGGCTGTGTCTGTCTCTTCTCGAGAAGAGACAGACACAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007852.1-37s1c1
Sequence:CCGGCTGGCCTTCCAGGTCCAGGCTCTCGAGAGCCTGGACCTGGAAGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks