EMAIL THIS PAGE TO A FRIEND

DEFB103A

defensin, beta 103A

15 Gene Product Result for
Synonyms: BD-3 DEFB-3 DEFB103 DEFB3 HBD3 HBP-3 HBP3 hBD-3
UniProtKB ID: P81534, Q8NFG6, Q9NPF6
Gene ID:
Horse(100063297) defensin, beta 103A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Proteins

Product # Description Species Add to Cart
 
SRP4524 BD-3 human recombinant, expressed in E. coli, ≥98% (SDS-PAGE) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081551 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001081551 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001081551 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001081551 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081551 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316403 predicted 375
2 SASI_Hs02_00316404 predicted 220
3 SASI_Hs02_00316405 predicted 288
4 SASI_Hs02_00316406 predicted 281
5 SASI_Hs02_00316407 predicted 279
6 SASI_Hs02_00316408 predicted 219
7 SASI_Hs02_00316409 predicted 378
8 SASI_Hs02_00316410 predicted 269
9 SASI_Hs02_00316411 predicted 395
10 SASI_Hs02_00316412 predicted 319
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081551
DEFB103A MISSION shRNA Bacterial Glycerol Stock
defensin, beta 103A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081551.2-341s21c1
Sequence:CCGGTGTGCTCAGCTGCCTTCCAAACTCGAGTTTGGAAGGCAGCTGAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081551.2-274s21c1
Sequence:CCGGCAGGTCATGGAGGAATCATAACTCGAGTTATGATTCCTCCATGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081551.2-402s21c1
Sequence:CCGGTGCTGCCGAAGAAAGAAATAACTCGAGTTATTTCTTTCTTCGGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081551.2-285s21c1
Sequence:CCGGGGAATCATAAACACATTACAGCTCGAGCTGTAATGTGTTTATGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081551.2-361s21c1
Sequence:CCGGAGGAGGAACAGATCGGCAAGTCTCGAGACTTGCCGATCTGTTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081551
DEFB103A MISSION shRNA shRNA Plasmid DNA
defensin, beta 103A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081551.2-341s21c1
Sequence:CCGGTGTGCTCAGCTGCCTTCCAAACTCGAGTTTGGAAGGCAGCTGAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081551.2-274s21c1
Sequence:CCGGCAGGTCATGGAGGAATCATAACTCGAGTTATGATTCCTCCATGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081551.2-402s21c1
Sequence:CCGGTGCTGCCGAAGAAAGAAATAACTCGAGTTATTTCTTTCTTCGGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081551.2-285s21c1
Sequence:CCGGGGAATCATAAACACATTACAGCTCGAGCTGTAATGTGTTTATGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081551.2-361s21c1
Sequence:CCGGAGGAGGAACAGATCGGCAAGTCTCGAGACTTGCCGATCTGTTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081551
DEFB103A MISSION shRNA Lentiviral Transduction Particles
defensin, beta 103A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081551.2-341s21c1
Sequence:CCGGTGTGCTCAGCTGCCTTCCAAACTCGAGTTTGGAAGGCAGCTGAGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081551.2-274s21c1
Sequence:CCGGCAGGTCATGGAGGAATCATAACTCGAGTTATGATTCCTCCATGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081551.2-402s21c1
Sequence:CCGGTGCTGCCGAAGAAAGAAATAACTCGAGTTATTTCTTTCTTCGGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081551.2-285s21c1
Sequence:CCGGGGAATCATAAACACATTACAGCTCGAGCTGTAATGTGTTTATGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081551.2-361s21c1
Sequence:CCGGAGGAGGAACAGATCGGCAAGTCTCGAGACTTGCCGATCTGTTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks