EMAIL THIS PAGE TO A FRIEND

DEFB103B

defensin, beta 103B

23 Gene Product Result for
Synonyms: BD-3 DEFB103 DEFB3 HBD3 HBP3
Species: Human DEFB103B(55894)
Gene ID:
Human(55894) Summary: Defensins form a family of microbicidal and cytotoxic peptides made by neutrophils. Members of the defensin family are highly similar in protein sequence. This gene encodes defensin, beta 103B, which has broad spectrum antimicrobial activity and may play an important role in innate epithelial defense. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018661 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018661 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018661 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018661 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018661 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352164 predicted 275
2 SASI_Hs02_00352165 predicted 251
3 SASI_Hs01_00104122 predicted 32
4 SASI_Hs02_00352166 predicted 260
5 SASI_Hs02_00352167 predicted 263
6 SASI_Hs02_00352168 predicted 240
7 SASI_Hs02_00352169 predicted 231
8 SASI_Hs02_00352170 predicted 100
9 SASI_Hs02_00352171 predicted 92
10 SASI_Hs01_00104124 predicted 84
11 SASI_Hs01_00104121 predicted 273
12 SASI_Hs01_00104123 predicted 268
13 SASI_Hs01_00104125 predicted 226
14 SASI_Hs01_00104126 predicted 280
15 SASI_Hs01_00104127 predicted 271
16 SASI_Hs01_00104128 predicted 226
17 SASI_Hs01_00104129 predicted 275
18 SASI_Hs01_00104130 predicted 275
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018661
DEFB103B MISSION shRNA Bacterial Glycerol Stock
defensin, beta 103B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018661.3-148s21c1
Sequence:CCGGTGTGCTGTGCTCAGCTGCCTTCTCGAGAAGGCAGCTGAGCACAGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018661.3-74s21c1
Sequence:CCGGTGGTGCCTGTTCCAGGTCATGCTCGAGCATGACCTGGAACAGGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018661.3-115s21c1
Sequence:CCGGCAGAAATATTATTGCAGAGTCCTCGAGGACTCTGCAATAATATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018661.3-271s21c1
Sequence:CCGGGAAATGCCTTCTTAAAGTTTACTCGAGTAAACTTTAAGAAGGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018661.3-215s21c1
Sequence:CCGAGCTGCCGAAGAAAGAAATAAACTCGAGTTTATTTCTTTCTTCGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018661.3-256s21c1
Sequence:CCGGGTGTTGTAAAGTGTGGAAATGCTCGAGCATTTCCACACTTTACAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018661.2-273s1c1
Sequence:CCGGCCAGGTCATGGAGGAATCATACTCGAGTATGATTCCTCCATGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018661.2-281s1c1
Sequence:CCGGTGGAGGAATCATAAACACATTCTCGAGAATGTGTTTATGATTCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018661.2-350s1c1
Sequence:CCGGCTGCCTTCCAAAGGAGGAACACTCGAGTGTTCCTCCTTTGGAAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018661.2-358s1c1
Sequence:CCGGCAAAGGAGGAACAGATCGGCACTCGAGTGCCGATCTGTTCCTCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018661
DEFB103B MISSION shRNA shRNA Plasmid DNA
defensin, beta 103B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018661.3-148s21c1
Sequence:CCGGTGTGCTGTGCTCAGCTGCCTTCTCGAGAAGGCAGCTGAGCACAGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018661.3-74s21c1
Sequence:CCGGTGGTGCCTGTTCCAGGTCATGCTCGAGCATGACCTGGAACAGGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018661.3-115s21c1
Sequence:CCGGCAGAAATATTATTGCAGAGTCCTCGAGGACTCTGCAATAATATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018661.3-271s21c1
Sequence:CCGGGAAATGCCTTCTTAAAGTTTACTCGAGTAAACTTTAAGAAGGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018661.3-215s21c1
Sequence:CCGAGCTGCCGAAGAAAGAAATAAACTCGAGTTTATTTCTTTCTTCGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018661.3-256s21c1
Sequence:CCGGGTGTTGTAAAGTGTGGAAATGCTCGAGCATTTCCACACTTTACAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018661.2-273s1c1
Sequence:CCGGCCAGGTCATGGAGGAATCATACTCGAGTATGATTCCTCCATGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018661.2-281s1c1
Sequence:CCGGTGGAGGAATCATAAACACATTCTCGAGAATGTGTTTATGATTCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018661.2-350s1c1
Sequence:CCGGCTGCCTTCCAAAGGAGGAACACTCGAGTGTTCCTCCTTTGGAAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018661.2-358s1c1
Sequence:CCGGCAAAGGAGGAACAGATCGGCACTCGAGTGCCGATCTGTTCCTCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018661
DEFB103B MISSION shRNA Lentiviral Transduction Particles
defensin, beta 103B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018661.3-148s21c1
Sequence:CCGGTGTGCTGTGCTCAGCTGCCTTCTCGAGAAGGCAGCTGAGCACAGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018661.3-74s21c1
Sequence:CCGGTGGTGCCTGTTCCAGGTCATGCTCGAGCATGACCTGGAACAGGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018661.3-115s21c1
Sequence:CCGGCAGAAATATTATTGCAGAGTCCTCGAGGACTCTGCAATAATATTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018661.3-271s21c1
Sequence:CCGGGAAATGCCTTCTTAAAGTTTACTCGAGTAAACTTTAAGAAGGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018661.3-215s21c1
Sequence:CCGAGCTGCCGAAGAAAGAAATAAACTCGAGTTTATTTCTTTCTTCGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433542    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018661.3-256s21c1
Sequence:CCGGGTGTTGTAAAGTGTGGAAATGCTCGAGCATTTCCACACTTTACAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018661.2-273s1c1
Sequence:CCGGCCAGGTCATGGAGGAATCATACTCGAGTATGATTCCTCCATGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018661.2-281s1c1
Sequence:CCGGTGGAGGAATCATAAACACATTCTCGAGAATGTGTTTATGATTCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018661.2-350s1c1
Sequence:CCGGCTGCCTTCCAAAGGAGGAACACTCGAGTGTTCCTCCTTTGGAAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018661.2-358s1c1
Sequence:CCGGCAAAGGAGGAACAGATCGGCACTCGAGTGCCGATCTGTTCCTCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks