EMAIL THIS PAGE TO A FRIEND

DEFB104A

defensin, beta 104A

26 Gene Product Result for
Synonyms: BD-4 DEFB-4 DEFB104 DEFB4 hBD-4
Species: Human DEFB104A(140596)
UniProtKB ID: Q8WTQ1, Q496I2, Q496I3, Q496I4
Gene ID:
Human(140596) Summary: Defensins form a family of microbicidal and cytotoxic peptides made by neutrophils. Defensins are short, processed peptide molecules that are classified by structure into three groups: alpha-defensins, beta-defensins and theta-defensins. All beta-defensin genes are densely clustered in four to five syntenic chromosomal regions. Chromosome 8p23 contains at least two copies of the duplicated beta-defensin cluster. This duplication results in two identical copies of defensin, beta 104, DEFB104A and DEFB104B, in head-to-head orientation. This gene, DEFB104A, represents the more centromeric copy. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080389 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080389 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080389 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080389 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080389 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046945 predicted 193
2 SASI_Hs02_00362221 predicted 26
3 SASI_Hs02_00362222 predicted 26
4 SASI_Hs01_00046946 predicted 199
5 SASI_Hs02_00362223 predicted 38
6 SASI_Hs01_00046947 predicted 164
7 SASI_Hs01_00046948 predicted 77
8 SASI_Hs01_00046950 predicted 250
9 SASI_Hs01_00046949 predicted 13
10 SASI_Hs01_00046951 predicted 57
11 SASI_Hs01_00046952 predicted 196
12 SASI_Hs01_00046953 predicted 27
13 SASI_Hs01_00046954 predicted 240
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080389
DEFB104A MISSION shRNA Bacterial Glycerol Stock
defensin, beta 104A
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080389.1-128s1c1
Sequence:CCGGGAAGAAATGTCGCAGCCAAGACTCGAGTCTTGGCTGCGACATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080389.1-63s1c1
Sequence:CCGGGATCTTCCAGTGAGAAGCGAACTCGAGTTCGCTTCTCACTGGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080389.1-69s1c1
Sequence:CCGGCCAGTGAGAAGCGAATTTGAACTCGAGTTCAAATTCGCTTCTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080389.1-97s1c1
Sequence:CCGGGAATATGTGGTTATGGGACTGCTCGAGCAGTCCCATAACCACATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080389.1-70s1c1
Sequence:CCGGCAGTGAGAAGCGAATTTGAATCTCGAGATTCAAATTCGCTTCTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080389.1-87s1c1
Sequence:CCGGGAATTGGACAGAATATGTGGTCTCGAGACCACATATTCTGTCCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080389.1-79s1c1
Sequence:CCGGGCGAATTTGAATTGGACAGAACTCGAGTTCTGTCCAATTCAAATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080389.1-131s1c1
Sequence:CCGGGAAATGTCGCAGCCAAGAATACTCGAGTATTCTTGGCTGCGACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080389.2-38s21c1
Sequence:CCGGAGCCATTTCTCTTCTACTCTACTCGAGTAGAGTAGAAGAGAAATGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080389.2-160s21c1
Sequence:CCGGGAAGATGTCCCAACACCTATGCTCGAGCATAGGTGTTGGGACATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080389.2-206s21c1
Sequence:CCGGGAGCTTACTGAATCGTACAAACTCGAGTTTGTACGATTCAGTAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080389
DEFB104A MISSION shRNA shRNA Plasmid DNA
defensin, beta 104A
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080389.1-128s1c1
Sequence:CCGGGAAGAAATGTCGCAGCCAAGACTCGAGTCTTGGCTGCGACATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080389.1-63s1c1
Sequence:CCGGGATCTTCCAGTGAGAAGCGAACTCGAGTTCGCTTCTCACTGGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080389.1-69s1c1
Sequence:CCGGCCAGTGAGAAGCGAATTTGAACTCGAGTTCAAATTCGCTTCTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080389.1-97s1c1
Sequence:CCGGGAATATGTGGTTATGGGACTGCTCGAGCAGTCCCATAACCACATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080389.1-70s1c1
Sequence:CCGGCAGTGAGAAGCGAATTTGAATCTCGAGATTCAAATTCGCTTCTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080389.1-87s1c1
Sequence:CCGGGAATTGGACAGAATATGTGGTCTCGAGACCACATATTCTGTCCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080389.1-79s1c1
Sequence:CCGGGCGAATTTGAATTGGACAGAACTCGAGTTCTGTCCAATTCAAATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080389.1-131s1c1
Sequence:CCGGGAAATGTCGCAGCCAAGAATACTCGAGTATTCTTGGCTGCGACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080389.2-38s21c1
Sequence:CCGGAGCCATTTCTCTTCTACTCTACTCGAGTAGAGTAGAAGAGAAATGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080389.2-160s21c1
Sequence:CCGGGAAGATGTCCCAACACCTATGCTCGAGCATAGGTGTTGGGACATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080389.2-206s21c1
Sequence:CCGGGAGCTTACTGAATCGTACAAACTCGAGTTTGTACGATTCAGTAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080389
DEFB104A MISSION shRNA Lentiviral Transduction Particles
defensin, beta 104A
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080389.1-128s1c1
Sequence:CCGGGAAGAAATGTCGCAGCCAAGACTCGAGTCTTGGCTGCGACATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080389.1-63s1c1
Sequence:CCGGGATCTTCCAGTGAGAAGCGAACTCGAGTTCGCTTCTCACTGGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080389.1-69s1c1
Sequence:CCGGCCAGTGAGAAGCGAATTTGAACTCGAGTTCAAATTCGCTTCTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080389.1-97s1c1
Sequence:CCGGGAATATGTGGTTATGGGACTGCTCGAGCAGTCCCATAACCACATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080389.1-70s1c1
Sequence:CCGGCAGTGAGAAGCGAATTTGAATCTCGAGATTCAAATTCGCTTCTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080389.1-87s1c1
Sequence:CCGGGAATTGGACAGAATATGTGGTCTCGAGACCACATATTCTGTCCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080389.1-79s1c1
Sequence:CCGGGCGAATTTGAATTGGACAGAACTCGAGTTCTGTCCAATTCAAATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080389.1-131s1c1
Sequence:CCGGGAAATGTCGCAGCCAAGAATACTCGAGTATTCTTGGCTGCGACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080389.2-38s21c1
Sequence:CCGGAGCCATTTCTCTTCTACTCTACTCGAGTAGAGTAGAAGAGAAATGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080389.2-160s21c1
Sequence:CCGGGAAGATGTCCCAACACCTATGCTCGAGCATAGGTGTTGGGACATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080389.2-206s21c1
Sequence:CCGGGAGCTTACTGAATCGTACAAACTCGAGTTTGTACGATTCAGTAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks