EMAIL THIS PAGE TO A FRIEND

DEFB104B

defensin, beta 104B

12 Gene Product Result for
Synonyms: BD-4 DEFB-4 hBD-4
Species: Human DEFB104B(503618)
Gene ID:
Human(503618) Summary: Defensins form a family of microbicidal and cytotoxic peptides made by neutrophils. Defensins are short, processed peptide molecules that are classified by structure into three groups: alpha-defensins, beta-defensins and theta-defensins. All beta-defensin genes are densely clustered in four to five syntenic chromosomal regions. Chromosome 8p23 contains at least two copies of the duplicated beta-defensin cluster. This duplication results in two identical copies of defensin, beta 104, DEFB104A and DEFB104B, in head-to-head orientation. This gene, DEFB104B, represents the more telomeric copy. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001040702 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001040702 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001040702 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040702 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040702 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309059 predicted 194
2 SASI_Hs02_00309060 predicted 19
3 SASI_Hs02_00309061 predicted 29
4 SASI_Hs02_00309062 predicted 195
5 SASI_Hs02_00309063 predicted 39
6 SASI_Hs02_00309064 predicted 168
7 SASI_Hs02_00309065 predicted 74
8 SASI_Hs02_00309066 predicted 249
9 SASI_Hs02_00309067 predicted 16
10 SASI_Hs02_00309068 predicted 61
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040702
DEFB104B MISSION shRNA Bacterial Glycerol Stock
defensin, beta 104B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040702.1-199s21c1
Sequence:CCGGGGGATGAGAGCTTACTGAATCCTCGAGGATTCAGTAAGCTCTCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040702.1-40s21c1
Sequence:CCGGCCATTTCTCTTCTACTCTATCCTCGAGGATAGAGTAGAAGAGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040702.1-67s21c1
Sequence:CCGGTTCCAGTGAGAAGCGAATTTGCTCGAGCAAATTCGCTTCTCACTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040702.1-261s21c1
Sequence:CCGGGCTGGAAGTAGGACCTCAGTACTCGAGTACTGAGGTCCTACTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040702.1-90s21c1
Sequence:CCGGTTGGACAGAATATGTGGTTATCTCGAGATAACCACATATTCTGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040702
DEFB104B MISSION shRNA shRNA Plasmid DNA
defensin, beta 104B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040702.1-199s21c1
Sequence:CCGGGGGATGAGAGCTTACTGAATCCTCGAGGATTCAGTAAGCTCTCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040702.1-40s21c1
Sequence:CCGGCCATTTCTCTTCTACTCTATCCTCGAGGATAGAGTAGAAGAGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040702.1-67s21c1
Sequence:CCGGTTCCAGTGAGAAGCGAATTTGCTCGAGCAAATTCGCTTCTCACTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040702.1-261s21c1
Sequence:CCGGGCTGGAAGTAGGACCTCAGTACTCGAGTACTGAGGTCCTACTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040702.1-90s21c1
Sequence:CCGGTTGGACAGAATATGTGGTTATCTCGAGATAACCACATATTCTGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040702
DEFB104B MISSION shRNA Lentiviral Transduction Particles
defensin, beta 104B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040702.1-199s21c1
Sequence:CCGGGGGATGAGAGCTTACTGAATCCTCGAGGATTCAGTAAGCTCTCATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040702.1-40s21c1
Sequence:CCGGCCATTTCTCTTCTACTCTATCCTCGAGGATAGAGTAGAAGAGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040702.1-67s21c1
Sequence:CCGGTTCCAGTGAGAAGCGAATTTGCTCGAGCAAATTCGCTTCTCACTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040702.1-261s21c1
Sequence:CCGGGCTGGAAGTAGGACCTCAGTACTCGAGTACTGAGGTCCTACTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040702.1-90s21c1
Sequence:CCGGTTGGACAGAATATGTGGTTATCTCGAGATAACCACATATTCTGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks