EMAIL THIS PAGE TO A FRIEND

DEFB105A

defensin, beta 105A

13 Gene Product Result for
Synonyms: BD-5 DEFB-5 DEFB105
UniProtKB ID: Q8NG35, A1A581, Q8IZN8
Gene ID:
Human(245908) Summary: Defensins form a family of microbicidal and cytotoxic peptides made by neutrophils. Defensins are short, processed peptide molecules that are classified by structure into three groups: alpha-defensins, beta-defensins and theta-defensins. All beta-defensin genes are densely clustered in four to five syntenic chromosomal regions. Chromosome 8p23 contains at least two copies of the duplicated beta-defensin cluster. This duplication results in two identical copies of defensin, beta 105, DEFB105A and DEFB105B, in tail-to-tail orientation. This gene, DEFB105A, represents the more centromeric copy. [provided by RefSeq, Jul 2008]
dog(100306932) defensin, beta 105A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152250 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152250 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152250 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152250 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152250 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185088 predicted 184
2 SASI_Hs01_00185089 predicted 193
3 SASI_Hs01_00185090 predicted 172
4 SASI_Hs01_00185091 predicted 176
5 SASI_Hs01_00185092 predicted 181
6 SASI_Hs01_00185094 predicted 176
7 SASI_Hs01_00185095 predicted 189
8 SASI_Hs02_00365749 predicted 118
9 SASI_Hs01_00185096 predicted 198
10 SASI_Hs01_00185097 predicted 177
11 SASI_Hs01_00185093 predicted 195
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152250
DEFB105A MISSION shRNA Bacterial Glycerol Stock
defensin, beta 105A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152250.1-28s21c1
Sequence:CCGGTTTCTATTTGCTATGTTCTTCCTCGAGGAAGAACATAGCAAATAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152250.1-72s21c1
Sequence:CCGGGTGCCAGGCAGGACTTGATTTCTCGAGAAATCAAGTCCTGCCTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152250.1-194s21c1
Sequence:CCGGGAAATTGCAGGCTGAACTTTCCTCGAGGAAAGTTCAGCCTGCAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152250.1-161s21c1
Sequence:CCGGGGAAGGAGTGCTTGGAGAATGCTCGAGCATTCTCCAAGCACTCCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152250.1-101s21c1
Sequence:CCGGCATTTCCATCAGGTGAGTTTGCTCGAGCAAACTCACCTGATGGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152250
DEFB105A MISSION shRNA shRNA Plasmid DNA
defensin, beta 105A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152250.1-28s21c1
Sequence:CCGGTTTCTATTTGCTATGTTCTTCCTCGAGGAAGAACATAGCAAATAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152250.1-72s21c1
Sequence:CCGGGTGCCAGGCAGGACTTGATTTCTCGAGAAATCAAGTCCTGCCTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152250.1-194s21c1
Sequence:CCGGGAAATTGCAGGCTGAACTTTCCTCGAGGAAAGTTCAGCCTGCAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152250.1-161s21c1
Sequence:CCGGGGAAGGAGTGCTTGGAGAATGCTCGAGCATTCTCCAAGCACTCCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152250.1-101s21c1
Sequence:CCGGCATTTCCATCAGGTGAGTTTGCTCGAGCAAACTCACCTGATGGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152250
DEFB105A MISSION shRNA Lentiviral Transduction Particles
defensin, beta 105A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152250.1-28s21c1
Sequence:CCGGTTTCTATTTGCTATGTTCTTCCTCGAGGAAGAACATAGCAAATAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152250.1-72s21c1
Sequence:CCGGGTGCCAGGCAGGACTTGATTTCTCGAGAAATCAAGTCCTGCCTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152250.1-194s21c1
Sequence:CCGGGAAATTGCAGGCTGAACTTTCCTCGAGGAAAGTTCAGCCTGCAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152250.1-161s21c1
Sequence:CCGGGGAAGGAGTGCTTGGAGAATGCTCGAGCATTCTCCAAGCACTCCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152250.1-101s21c1
Sequence:CCGGCATTTCCATCAGGTGAGTTTGCTCGAGCAAACTCACCTGATGGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks