EMAIL THIS PAGE TO A FRIEND

DEFB105B

defensin, beta 105B

Synonyms: BD-5 DEFB-5
Species: Human DEFB105B(504180)
Gene ID:
Human(504180) Summary: Defensins form a family of microbicidal and cytotoxic peptides made by neutrophils. Defensins are short, processed peptide molecules that are classified by structure into three groups: alpha-defensins, beta-defensins and theta-defensins. All beta-defensin genes are densely clustered in four to five syntenic chromosomal regions. Chromosome 8p23 contains at least two copies of the duplicated beta-defensin cluster. This duplication results in two identical copies of defensin, beta 105, DEFB105A and DEFB105B, in tail-to-tail orientation. This gene, DEFB105B, represents the more telomeric copy. [provided by RefSeq, Jul 2008]
12 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001040703 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001040703 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001040703 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040703 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040703 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309069 predicted 189
2 SASI_Hs02_00309070 predicted 197
3 SASI_Hs02_00309071 predicted 172
4 SASI_Hs02_00309072 predicted 167
5 SASI_Hs02_00309073 predicted 179
6 SASI_Hs02_00309074 predicted 177
7 SASI_Hs02_00309075 predicted 191
8 SASI_Hs02_00309076 predicted 112
9 SASI_Hs02_00309077 predicted 197
10 SASI_Hs02_00309078 predicted 181
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040703
DEFB105B MISSION shRNA Bacterial Glycerol Stock
defensin, beta 105B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040703.1-156s21c1
Sequence:CCGGATGCAGGAAGGAGTGCTTGGACTCGAGTCCAAGCACTCCTTCCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040703.1-125s21c1
Sequence:CCGGTCTGTGAGTCGTGCAAGCTTGCTCGAGCAAGCTTGCACGACTCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040703.1-102s21c1
Sequence:CCGGATTTCCATCAGGTGAGTTTGCCTCGAGGCAAACTCACCTGATGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040703.1-179s21c1
Sequence:CCGGATGAGAAGCCCGATGGAAATTCTCGAGAATTTCCATCGGGCTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040703.1-29s21c1
Sequence:CCGGTTCTATTTGCTATGTTCTTCACTCGAGTGAAGAACATAGCAAATAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040703
DEFB105B MISSION shRNA shRNA Plasmid DNA
defensin, beta 105B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040703.1-156s21c1
Sequence:CCGGATGCAGGAAGGAGTGCTTGGACTCGAGTCCAAGCACTCCTTCCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040703.1-125s21c1
Sequence:CCGGTCTGTGAGTCGTGCAAGCTTGCTCGAGCAAGCTTGCACGACTCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040703.1-102s21c1
Sequence:CCGGATTTCCATCAGGTGAGTTTGCCTCGAGGCAAACTCACCTGATGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040703.1-179s21c1
Sequence:CCGGATGAGAAGCCCGATGGAAATTCTCGAGAATTTCCATCGGGCTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040703.1-29s21c1
Sequence:CCGGTTCTATTTGCTATGTTCTTCACTCGAGTGAAGAACATAGCAAATAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040703
DEFB105B MISSION shRNA Lentiviral Transduction Particles
defensin, beta 105B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040703.1-156s21c1
Sequence:CCGGATGCAGGAAGGAGTGCTTGGACTCGAGTCCAAGCACTCCTTCCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040703.1-125s21c1
Sequence:CCGGTCTGTGAGTCGTGCAAGCTTGCTCGAGCAAGCTTGCACGACTCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040703.1-102s21c1
Sequence:CCGGATTTCCATCAGGTGAGTTTGCCTCGAGGCAAACTCACCTGATGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040703.1-179s21c1
Sequence:CCGGATGAGAAGCCCGATGGAAATTCTCGAGAATTTCCATCGGGCTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040703.1-29s21c1
Sequence:CCGGTTCTATTTGCTATGTTCTTCACTCGAGTGAAGAACATAGCAAATAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks