EMAIL THIS PAGE TO A FRIEND

DEFB106A

defensin, beta 106A

13 Gene Product Result for
Synonyms: BD-6 DEFB-6 DEFB106
Species: Human DEFB106A(245909)
UniProtKB ID: Q8N104, Q2NKR0, Q496I8
Gene ID:
Human(245909) Summary: Defensins form a family of microbicidal and cytotoxic peptides made by neutrophils. Defensins are short, processed peptide molecules that are classified by structure into three groups: alpha-defensins, beta-defensins and theta-defensins. All beta-defensin genes are densely clustered in four to five syntenic chromosomal regions. Chromosome 8p23 contains at least two copies of the duplicated beta-defensin cluster. This duplication results in two identical copies of defensin, beta 106, DEFB106A and DEFB106B, in head-to-head orientation. This gene, DEFB106A, represents the more centromeric copy. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152251 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152251 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152251 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152251 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152251 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080665 predicted 211
2 SASI_Hs01_00080666 predicted 171
3 SASI_Hs01_00080667 predicted 170
4 SASI_Hs01_00080669 predicted 258
5 SASI_Hs02_00365750 predicted 182
6 SASI_Hs01_00080670 predicted 223
7 SASI_Hs01_00080671 predicted 228
8 SASI_Hs01_00080672 predicted 82
9 SASI_Hs01_00080673 predicted 174
10 SASI_Hs01_00080674 predicted 76
11 SASI_Hs01_00080668 predicted 274
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152251
DEFB106A MISSION shRNA Bacterial Glycerol Stock
defensin, beta 106A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152251.2-125s1c1
Sequence:CCGGCGAAGAACTTATTGCTCTCTGCTCGAGCAGAGAGCAATAAGTTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152251.2-147s1c1
Sequence:CCGGCAGAAGTCTCTGAAATGCTGTCTCGAGACAGCATTTCAGAGACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152251.2-82s1c1
Sequence:CCGGGCAACAAACTTAAAGGGACATCTCGAGATGTCCCTTTAAGTTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152251.2-86s1c1
Sequence:CCGGCAAACTTAAAGGGACATGCAACTCGAGTTGCATGTCCCTTTAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152251.2-83s1c1
Sequence:CCGGCAACAAACTTAAAGGGACATGCTCGAGCATGTCCCTTTAAGTTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152251
DEFB106A MISSION shRNA shRNA Plasmid DNA
defensin, beta 106A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152251.2-125s1c1
Sequence:CCGGCGAAGAACTTATTGCTCTCTGCTCGAGCAGAGAGCAATAAGTTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152251.2-147s1c1
Sequence:CCGGCAGAAGTCTCTGAAATGCTGTCTCGAGACAGCATTTCAGAGACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152251.2-82s1c1
Sequence:CCGGGCAACAAACTTAAAGGGACATCTCGAGATGTCCCTTTAAGTTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152251.2-86s1c1
Sequence:CCGGCAAACTTAAAGGGACATGCAACTCGAGTTGCATGTCCCTTTAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152251.2-83s1c1
Sequence:CCGGCAACAAACTTAAAGGGACATGCTCGAGCATGTCCCTTTAAGTTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152251
DEFB106A MISSION shRNA Lentiviral Transduction Particles
defensin, beta 106A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152251.2-125s1c1
Sequence:CCGGCGAAGAACTTATTGCTCTCTGCTCGAGCAGAGAGCAATAAGTTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152251.2-147s1c1
Sequence:CCGGCAGAAGTCTCTGAAATGCTGTCTCGAGACAGCATTTCAGAGACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152251.2-82s1c1
Sequence:CCGGGCAACAAACTTAAAGGGACATCTCGAGATGTCCCTTTAAGTTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152251.2-86s1c1
Sequence:CCGGCAAACTTAAAGGGACATGCAACTCGAGTTGCATGTCCCTTTAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152251.2-83s1c1
Sequence:CCGGCAACAAACTTAAAGGGACATGCTCGAGCATGTCCCTTTAAGTTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks