EMAIL THIS PAGE TO A FRIEND

DEFB106B

defensin, beta 106B

Synonyms: BD-6 DEFB-6
Species: Human DEFB106B(503841)
Gene ID:
Human(503841) Summary: Defensins form a family of microbicidal and cytotoxic peptides made by neutrophils. Defensins are short, processed peptide molecules that are classified by structure into three groups: alpha-defensins, beta-defensins and theta-defensins. All beta-defensin genes are densely clustered in four to five syntenic chromosomal regions. Chromosome 8p23 contains at least two copies of the duplicated beta-defensin cluster. This duplication results in two identical copies of defensin, beta 106, DEFB106A and DEFB106B, in head-to-head orientation. This gene, DEFB106B, represents the more telomeric copy. [provided by RefSeq, Jul 2008]
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001040704 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001040704 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001040704 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040704 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309079 predicted 213
2 SASI_Hs02_00309080 predicted 179
3 SASI_Hs02_00309081 predicted 169
4 SASI_Hs02_00309082 predicted 261
5 SASI_Hs02_00309083 predicted 181
6 SASI_Hs02_00309084 predicted 224
7 SASI_Hs02_00309085 predicted 220
8 SASI_Hs02_00309086 predicted 80
9 SASI_Hs02_00309087 predicted 174
10 SASI_Hs02_00309088 predicted 72
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040704
DEFB106B MISSION shRNA Bacterial Glycerol Stock
defensin, beta 106B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040704.1-6s21c1
Sequence:CCGGATGAGGACTTTCCTCTTTCTCCTCGAGGAGAAAGAGGAAAGTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040704.1-25s21c1
Sequence:CCGGTCTTTGCCGTGCTCTTCTTTCCTCGAGGAAAGAAGAGCACGGCAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040704.1-133s21c1
Sequence:CCGGTTATTGCTCTCTGCCAGAAGTCTCGAGACTTCTGGCAGAGAGCAATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040704.1-70s21c1
Sequence:CCGGTTGATGAGAAATGCAACAAACCTCGAGGTTTGTTGCATTTCTCATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040704.1-95s21c1
Sequence:CCGGAGGGACATGCAAGAACAATTGCTCGAGCAATTGTTCTTGCATGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040704
DEFB106B MISSION shRNA shRNA Plasmid DNA
defensin, beta 106B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040704.1-6s21c1
Sequence:CCGGATGAGGACTTTCCTCTTTCTCCTCGAGGAGAAAGAGGAAAGTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040704.1-25s21c1
Sequence:CCGGTCTTTGCCGTGCTCTTCTTTCCTCGAGGAAAGAAGAGCACGGCAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040704.1-133s21c1
Sequence:CCGGTTATTGCTCTCTGCCAGAAGTCTCGAGACTTCTGGCAGAGAGCAATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040704.1-70s21c1
Sequence:CCGGTTGATGAGAAATGCAACAAACCTCGAGGTTTGTTGCATTTCTCATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040704.1-95s21c1
Sequence:CCGGAGGGACATGCAAGAACAATTGCTCGAGCAATTGTTCTTGCATGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040704
DEFB106B MISSION shRNA Lentiviral Transduction Particles
defensin, beta 106B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040704.1-6s21c1
Sequence:CCGGATGAGGACTTTCCTCTTTCTCCTCGAGGAGAAAGAGGAAAGTCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040704.1-25s21c1
Sequence:CCGGTCTTTGCCGTGCTCTTCTTTCCTCGAGGAAAGAAGAGCACGGCAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040704.1-133s21c1
Sequence:CCGGTTATTGCTCTCTGCCAGAAGTCTCGAGACTTCTGGCAGAGAGCAATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040704.1-70s21c1
Sequence:CCGGTTGATGAGAAATGCAACAAACCTCGAGGTTTGTTGCATTTCTCATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040704.1-95s21c1
Sequence:CCGGAGGGACATGCAAGAACAATTGCTCGAGCAATTGTTCTTGCATGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks