EMAIL THIS PAGE TO A FRIEND

DEFB107A

defensin, beta 107A

14 Gene Product Result for
Synonyms: BD-7 DEFB-7 DEFB107
Species: Human DEFB107A(245910)
UniProtKB ID: Q8IZN7, B2RPM1, Q30E75, Q8NET2
Gene ID:
Human(245910) Summary: Defensins form a family of microbicidal and cytotoxic peptides made by neutrophils. Defensins are short, processed peptide molecules that are classified by structure into three groups: alpha-defensins, beta-defensins and theta-defensins. All beta-defensin genes are densely clustered in four to five syntenic chromosomal regions. Chromosome 8p23 contains at least two copies of the duplicated beta-defensin cluster. This duplication results in two identical copies of defensin, beta 107, DEFB107A and DEFB107B, in tail-to-tail orientation. This gene, DEFB107A, represents the more centromeric copy. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA045626 Anti-DEFB107A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001037668 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001037668 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001037668 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037668 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037668 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030229 predicted 248
2 SASI_Hs01_00030230 predicted 157
3 SASI_Hs01_00030231 predicted 152
4 SASI_Hs01_00030232 predicted 342
5 SASI_Hs01_00030233 predicted 213
6 SASI_Hs01_00030234 predicted 338
7 SASI_Hs01_00030235 predicted 349
8 SASI_Hs01_00030236 predicted 157
9 SASI_Hs01_00030238 predicted 342
10 SASI_Hs02_00308346 predicted 167
11 SASI_Hs01_00030237 predicted 198
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037668
DEFB107A MISSION shRNA Bacterial Glycerol Stock
defensin, beta 107A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037668.1-212s1c1
Sequence:CCGGGAAGCCGAATGTCTTACCTTTCTCGAGAAAGGTAAGACATTCGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037668.1-128s1c1
Sequence:CCGGGCTCTCATTCTTCTTGCTCAACTCGAGTTGAGCAAGAAGAATGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037668.1-163s1c1
Sequence:CCGGGACAGCAATTCATAGAGCACTCTCGAGAGTGCTCTATGAATTGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037668.1-217s1c1
Sequence:CCGGCGAATGTCTTACCTTTGAAGTCTCGAGACTTCAAAGGTAAGACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037668.1-165s1c1
Sequence:CCGGCAGCAATTCATAGAGCACTAACTCGAGTTAGTGCTCTATGAATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037668.1-216s1c1
Sequence:CCGGCCGAATGTCTTACCTTTGAAGCTCGAGCTTCAAAGGTAAGACATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037668.1-215s1c1
Sequence:CCGGGCCGAATGTCTTACCTTTGAACTCGAGTTCAAAGGTAAGACATTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037668
DEFB107A MISSION shRNA shRNA Plasmid DNA
defensin, beta 107A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037668.1-212s1c1
Sequence:CCGGGAAGCCGAATGTCTTACCTTTCTCGAGAAAGGTAAGACATTCGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037668.1-128s1c1
Sequence:CCGGGCTCTCATTCTTCTTGCTCAACTCGAGTTGAGCAAGAAGAATGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037668.1-163s1c1
Sequence:CCGGGACAGCAATTCATAGAGCACTCTCGAGAGTGCTCTATGAATTGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037668.1-217s1c1
Sequence:CCGGCGAATGTCTTACCTTTGAAGTCTCGAGACTTCAAAGGTAAGACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037668.1-165s1c1
Sequence:CCGGCAGCAATTCATAGAGCACTAACTCGAGTTAGTGCTCTATGAATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037668.1-216s1c1
Sequence:CCGGCCGAATGTCTTACCTTTGAAGCTCGAGCTTCAAAGGTAAGACATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037668.1-215s1c1
Sequence:CCGGGCCGAATGTCTTACCTTTGAACTCGAGTTCAAAGGTAAGACATTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037668
DEFB107A MISSION shRNA Lentiviral Transduction Particles
defensin, beta 107A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037668.1-212s1c1
Sequence:CCGGGAAGCCGAATGTCTTACCTTTCTCGAGAAAGGTAAGACATTCGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037668.1-128s1c1
Sequence:CCGGGCTCTCATTCTTCTTGCTCAACTCGAGTTGAGCAAGAAGAATGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037668.1-163s1c1
Sequence:CCGGGACAGCAATTCATAGAGCACTCTCGAGAGTGCTCTATGAATTGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037668.1-217s1c1
Sequence:CCGGCGAATGTCTTACCTTTGAAGTCTCGAGACTTCAAAGGTAAGACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037668.1-165s1c1
Sequence:CCGGCAGCAATTCATAGAGCACTAACTCGAGTTAGTGCTCTATGAATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037668.1-216s1c1
Sequence:CCGGCCGAATGTCTTACCTTTGAAGCTCGAGCTTCAAAGGTAAGACATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001037668.1-215s1c1
Sequence:CCGGGCCGAATGTCTTACCTTTGAACTCGAGTTCAAAGGTAAGACATTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks