EMAIL THIS PAGE TO A FRIEND

DEFB107B

defensin, beta 107B

19 Gene Product Result for
Synonyms: HsT21816
Species: Human DEFB107B(503614)
Gene ID:
Human(503614) Summary: Defensins form a family of microbicidal and cytotoxic peptides made by neutrophils. Defensins are short, processed peptide molecules that are classified by structure into three groups: alpha-defensins, beta-defensins and theta-defensins. All beta-defensin genes are densely clustered in four to five syntenic chromosomal regions. Chromosome 8p23 contains at least two copies of the duplicated beta-defensin cluster. This duplication results in two identical copies of defensin, beta 107, DEFB107A and DEFB107B, in tail-to-tail orientation. This gene, DEFB107B, represents the more telomeric copy. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001040705 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001040705 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001040705 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040705 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040705 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309089 predicted 241
2 SASI_Hs02_00309090 predicted 166
3 SASI_Hs02_00309091 predicted 152
4 SASI_Hs02_00309092 predicted 344
5 SASI_Hs02_00309093 predicted 207
6 SASI_Hs02_00309094 predicted 337
7 SASI_Hs02_00309095 predicted 346
8 SASI_Hs02_00309096 predicted 156
9 SASI_Hs02_00309097 predicted 348
10 SASI_Hs02_00309098 predicted 171
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040705
DEFB107B MISSION shRNA Bacterial Glycerol Stock
defensin, beta 107B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040705.1-132s21c1
Sequence:CCGGTCATTCTTCTTGCTCAAATTTCTCGAGAAATTTGAGCAAGAAGAATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040705.1-208s21c1
Sequence:CCGGCTGTGAAGCCGAATGTCTTACCTCGAGGTAAGACATTCGGCTTCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040705.1-157s21c1
Sequence:CCGGAGCCAGGACAGCAATTCATAGCTCGAGCTATGAATTGCTGTCCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040705.1-121s21c1
Sequence:CCGGTTTGGCTGCTCTCATTCTTCTCTCGAGAGAAGAATGAGAGCAGCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040705.1-168s21c1
Sequence:CCGGCAATTCATAGAGCACTAATTACTCGAGTAATTAGTGCTCTATGAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040705
DEFB107B MISSION shRNA shRNA Plasmid DNA
defensin, beta 107B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040705.1-132s21c1
Sequence:CCGGTCATTCTTCTTGCTCAAATTTCTCGAGAAATTTGAGCAAGAAGAATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040705.1-208s21c1
Sequence:CCGGCTGTGAAGCCGAATGTCTTACCTCGAGGTAAGACATTCGGCTTCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040705.1-157s21c1
Sequence:CCGGAGCCAGGACAGCAATTCATAGCTCGAGCTATGAATTGCTGTCCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040705.1-121s21c1
Sequence:CCGGTTTGGCTGCTCTCATTCTTCTCTCGAGAGAAGAATGAGAGCAGCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040705.1-168s21c1
Sequence:CCGGCAATTCATAGAGCACTAATTACTCGAGTAATTAGTGCTCTATGAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040705
DEFB107B MISSION shRNA Lentiviral Transduction Particles
defensin, beta 107B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040705.1-132s21c1
Sequence:CCGGTCATTCTTCTTGCTCAAATTTCTCGAGAAATTTGAGCAAGAAGAATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040705.1-208s21c1
Sequence:CCGGCTGTGAAGCCGAATGTCTTACCTCGAGGTAAGACATTCGGCTTCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040705.1-157s21c1
Sequence:CCGGAGCCAGGACAGCAATTCATAGCTCGAGCTATGAATTGCTGTCCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040705.1-121s21c1
Sequence:CCGGTTTGGCTGCTCTCATTCTTCTCTCGAGAGAAGAATGAGAGCAGCCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040705.1-168s21c1
Sequence:CCGGCAATTCATAGAGCACTAATTACTCGAGTAATTAGTGCTCTATGAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)