EMAIL THIS PAGE TO A FRIEND

DEFB108B

defensin, beta 108B

6 Gene Product Result for
Species: Human DEFB108B(245911)
UniProtKB ID: Q8NET1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001002035 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002035 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002035 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002035 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002035 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028375 predicted 3
2 SASI_Hs01_00028376 predicted 4
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002035
DEFB108B MISSION shRNA Bacterial Glycerol Stock
defensin, beta 108B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002035.1-188s21c1
Sequence:CCGGCAAGAATTGAGAGCACTACACCTCGAGGTGTAGTGCTCTCAATTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002035.1-118s21c1
Sequence:CCGGCTTGAAACAGAAATCCATGTTCTCGAGAACATGGATTTCTGTTTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002035.1-130s21c1
Sequence:CCGGATCCATGTTGGGAGATGTTTACTCGAGTAAACATCTCCCAACATGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002035.1-65s21c1
Sequence:CCGGGCAAATTCAAGGAGATCTGTGCTCGAGCACAGATCTCCTTGAATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002035.1-76s21c1
Sequence:CCGGGAGATCTGTGAACGTCCAAATCTCGAGATTTGGACGTTCACAGATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002035
DEFB108B MISSION shRNA shRNA Plasmid DNA
defensin, beta 108B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002035.1-188s21c1
Sequence:CCGGCAAGAATTGAGAGCACTACACCTCGAGGTGTAGTGCTCTCAATTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002035.1-118s21c1
Sequence:CCGGCTTGAAACAGAAATCCATGTTCTCGAGAACATGGATTTCTGTTTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002035.1-130s21c1
Sequence:CCGGATCCATGTTGGGAGATGTTTACTCGAGTAAACATCTCCCAACATGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002035.1-65s21c1
Sequence:CCGGGCAAATTCAAGGAGATCTGTGCTCGAGCACAGATCTCCTTGAATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002035.1-76s21c1
Sequence:CCGGGAGATCTGTGAACGTCCAAATCTCGAGATTTGGACGTTCACAGATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002035
DEFB108B MISSION shRNA Lentiviral Transduction Particles
defensin, beta 108B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002035.1-188s21c1
Sequence:CCGGCAAGAATTGAGAGCACTACACCTCGAGGTGTAGTGCTCTCAATTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002035.1-118s21c1
Sequence:CCGGCTTGAAACAGAAATCCATGTTCTCGAGAACATGGATTTCTGTTTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002035.1-130s21c1
Sequence:CCGGATCCATGTTGGGAGATGTTTACTCGAGTAAACATCTCCCAACATGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002035.1-65s21c1
Sequence:CCGGGCAAATTCAAGGAGATCTGTGCTCGAGCACAGATCTCCTTGAATTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002035.1-76s21c1
Sequence:CCGGGAGATCTGTGAACGTCCAAATCTCGAGATTTGGACGTTCACAGATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)