EMAIL THIS PAGE TO A FRIEND

DEFB109P1B

defensin, beta 109, pseudogene 1B

22 Gene Product Result for
Synonyms: DEF109P1B DEFB109
Species: Human DEFB109P1B(641517)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001037380 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001037380 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001037380 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037380 Rosetta Predictions human pricing
NR_003668 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037380 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162816 predicted 111
2 SASI_Hs01_00162817 predicted 209
3 SASI_Hs01_00162818 predicted 80
4 SASI_Hs01_00162819 predicted 133
5 SASI_Hs01_00162820 predicted 218
6 SASI_Hs01_00162821 predicted 85
7 SASI_Hs01_00162822 predicted 212
8 SASI_Hs01_00162823 predicted 217
9 SASI_Hs01_00162824 predicted 82
10 SASI_Hs01_00162825 predicted 55
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003668 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00380028 predicted 5308
2 SASI_Hs02_00380029 predicted 4589
3 SASI_Hs02_00380030 predicted 519
4 SASI_Hs02_00380031 predicted 5230
5 SASI_Hs02_00380032 predicted 5244
6 SASI_Hs02_00380033 predicted 6852
7 SASI_Hs02_00380034 predicted 4926
8 SASI_Hs02_00380035 predicted 5322
9 SASI_Hs02_00380036 predicted 208
10 SASI_Hs02_00380037 predicted 5326
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037380
DEFB109P1B MISSION shRNA Bacterial Glycerol Stock
defensin, beta 109, pseudogene 1B
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000180580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037380.1-113s1c1
Sequence:CCGGGCAGAACAGATGTCTGCAACACTCGAGTGTTGCAGACATCTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037380.1-114s1c1
Sequence:CCGGCAGAACAGATGTCTGCAACATCTCGAGATGTTGCAGACATCTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037380.1-80s1c1
Sequence:CCGGCGGAAGGTCATTGTCTCAATTCTCGAGAATTGAGACAATGACCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037380
DEFB109P1B MISSION shRNA shRNA Plasmid DNA
defensin, beta 109, pseudogene 1B
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000180580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037380.1-113s1c1
Sequence:CCGGGCAGAACAGATGTCTGCAACACTCGAGTGTTGCAGACATCTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037380.1-114s1c1
Sequence:CCGGCAGAACAGATGTCTGCAACATCTCGAGATGTTGCAGACATCTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037380.1-80s1c1
Sequence:CCGGCGGAAGGTCATTGTCTCAATTCTCGAGAATTGAGACAATGACCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037380
DEFB109P1B MISSION shRNA Lentiviral Transduction Particles
defensin, beta 109, pseudogene 1B
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000180580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037380.1-113s1c1
Sequence:CCGGGCAGAACAGATGTCTGCAACACTCGAGTGTTGCAGACATCTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037380.1-114s1c1
Sequence:CCGGCAGAACAGATGTCTGCAACATCTCGAGATGTTGCAGACATCTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037380.1-80s1c1
Sequence:CCGGCGGAAGGTCATTGTCTCAATTCTCGAGAATTGAGACAATGACCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks