EMAIL THIS PAGE TO A FRIEND

DEFB112

defensin, beta 112

17 Gene Product Result for
Synonyms: DEFB-12
UniProtKB ID: Q30KQ8, Q8NET0
Gene ID:
cow(101906162) defensin, beta 112
domestic cat(101094597) defensin, beta 112
dog(100685925) defensin, beta 112
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001037498 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001037498 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001037498 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037498 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037498 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179698 predicted 292
2 SASI_Hs01_00179699 predicted 254
3 SASI_Hs01_00179700 predicted 197
4 SASI_Hs01_00179701 predicted 190
5 SASI_Hs01_00179702 predicted 115
6 SASI_Hs01_00179703 predicted 215
7 SASI_Hs01_00179704 predicted 124
8 SASI_Hs01_00179705 predicted 147
9 SASI_Hs01_00179706 predicted 284
10 SASI_Hs01_00179707 predicted 160
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037498
DEFB112 MISSION shRNA Bacterial Glycerol Stock
defensin, beta 112
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037498.1-166s1c1
Sequence:CCGGGCGATTGGAGGTCGATGTAAACTCGAGTTTACATCGACCTCCAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037498.1-140s1c1
Sequence:CCGGCCTTTAGTAGGTGGAAGTCATCTCGAGATGACTTCCACCTACTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037498.1-118s21c1
Sequence:CCGGAGAAGTGAAGGGCACCATATCCTCGAGGATATGGTGCCCTTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037498.1-166s21c1
Sequence:CCGGGCGATTGGAGGTCGATGTAAACTCGAGTTTACATCGACCTCCAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037498.1-59s21c1
Sequence:CCGGATACATCTTCCACAATATTTGCTCGAGCAAATATTGTGGAAGATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037498.1-45s21c1
Sequence:CCGGGTACTCAAAGACAAATACATCCTCGAGGATGTATTTGTCTTTGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037498.1-152s21c1
Sequence:CCGGGGAAGTCATGTACAGCGATTGCTCGAGCAATCGCTGTACATGACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037498
DEFB112 MISSION shRNA shRNA Plasmid DNA
defensin, beta 112
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037498.1-166s1c1
Sequence:CCGGGCGATTGGAGGTCGATGTAAACTCGAGTTTACATCGACCTCCAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037498.1-140s1c1
Sequence:CCGGCCTTTAGTAGGTGGAAGTCATCTCGAGATGACTTCCACCTACTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037498.1-118s21c1
Sequence:CCGGAGAAGTGAAGGGCACCATATCCTCGAGGATATGGTGCCCTTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037498.1-166s21c1
Sequence:CCGGGCGATTGGAGGTCGATGTAAACTCGAGTTTACATCGACCTCCAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037498.1-59s21c1
Sequence:CCGGATACATCTTCCACAATATTTGCTCGAGCAAATATTGTGGAAGATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037498.1-45s21c1
Sequence:CCGGGTACTCAAAGACAAATACATCCTCGAGGATGTATTTGTCTTTGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037498.1-152s21c1
Sequence:CCGGGGAAGTCATGTACAGCGATTGCTCGAGCAATCGCTGTACATGACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037498
DEFB112 MISSION shRNA Lentiviral Transduction Particles
defensin, beta 112
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037498.1-166s1c1
Sequence:CCGGGCGATTGGAGGTCGATGTAAACTCGAGTTTACATCGACCTCCAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178766    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001037498.1-140s1c1
Sequence:CCGGCCTTTAGTAGGTGGAAGTCATCTCGAGATGACTTCCACCTACTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037498.1-118s21c1
Sequence:CCGGAGAAGTGAAGGGCACCATATCCTCGAGGATATGGTGCCCTTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037498.1-166s21c1
Sequence:CCGGGCGATTGGAGGTCGATGTAAACTCGAGTTTACATCGACCTCCAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037498.1-59s21c1
Sequence:CCGGATACATCTTCCACAATATTTGCTCGAGCAAATATTGTGGAAGATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037498.1-45s21c1
Sequence:CCGGGTACTCAAAGACAAATACATCCTCGAGGATGTATTTGTCTTTGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037498.1-152s21c1
Sequence:CCGGGGAAGTCATGTACAGCGATTGCTCGAGCAATCGCTGTACATGACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks