EMAIL THIS PAGE TO A FRIEND

DEFB113

defensin, beta 113

16 Gene Product Result for
Synonyms: DEFB-13
UniProtKB ID: Q30KQ7
Gene ID:
dog(100685694) defensin, beta 113
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001037729 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001037729 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001037729 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037729 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037729 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104648 predicted 131
2 SASI_Hs01_00104649 predicted 182
3 SASI_Hs01_00104650 predicted 96
4 SASI_Hs01_00104651 predicted 178
5 SASI_Hs01_00104652 predicted 130
6 SASI_Hs01_00104653 predicted 154
7 SASI_Hs01_00104654 predicted 108
8 SASI_Hs01_00104655 predicted 181
9 SASI_Hs01_00104657 predicted 130
10 SASI_Hs02_00308350 predicted 156
11 SASI_Hs01_00104656 predicted 42
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037729
DEFB113 MISSION shRNA Bacterial Glycerol Stock
defensin, beta 113
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037729.1-102s21c1
Sequence:CCGGATGTCAGCTTGTTCGTGGTGCCTCGAGGCACCACGAACAAGCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037729.1-133s21c1
Sequence:CCGGGAATGCAACAGCTGGGAATATCTCGAGATATTCCCAGCTGTTGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037729.1-38s21c1
Sequence:CCGGCTGTGTCTTGTGGTCCATCAGCTCGAGCTGATGGACCACAAGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037729.1-181s21c1
Sequence:CCGGTGCTGTGCGGTATGGGAATACCTCGAGGTATTCCCATACCGCACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037729.1-158s21c1
Sequence:CCGGATTATTACTGCAATGTTAACCCTCGAGGGTTAACATTGCAGTAATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037729
DEFB113 MISSION shRNA shRNA Plasmid DNA
defensin, beta 113
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037729.1-102s21c1
Sequence:CCGGATGTCAGCTTGTTCGTGGTGCCTCGAGGCACCACGAACAAGCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037729.1-133s21c1
Sequence:CCGGGAATGCAACAGCTGGGAATATCTCGAGATATTCCCAGCTGTTGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037729.1-38s21c1
Sequence:CCGGCTGTGTCTTGTGGTCCATCAGCTCGAGCTGATGGACCACAAGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037729.1-181s21c1
Sequence:CCGGTGCTGTGCGGTATGGGAATACCTCGAGGTATTCCCATACCGCACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037729.1-158s21c1
Sequence:CCGGATTATTACTGCAATGTTAACCCTCGAGGGTTAACATTGCAGTAATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037729
DEFB113 MISSION shRNA Lentiviral Transduction Particles
defensin, beta 113
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037729.1-102s21c1
Sequence:CCGGATGTCAGCTTGTTCGTGGTGCCTCGAGGCACCACGAACAAGCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037729.1-133s21c1
Sequence:CCGGGAATGCAACAGCTGGGAATATCTCGAGATATTCCCAGCTGTTGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037729.1-38s21c1
Sequence:CCGGCTGTGTCTTGTGGTCCATCAGCTCGAGCTGATGGACCACAAGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037729.1-181s21c1
Sequence:CCGGTGCTGTGCGGTATGGGAATACCTCGAGGTATTCCCATACCGCACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037729.1-158s21c1
Sequence:CCGGATTATTACTGCAATGTTAACCCTCGAGGGTTAACATTGCAGTAATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks