EMAIL THIS PAGE TO A FRIEND

DEFB114

defensin, beta 114

15 Gene Product Result for
Synonyms: DEFB-14 DEFB14
UniProtKB ID: Q30KQ6, Q8NES9
Gene ID:
dog(100685622) defensin, beta 114
cow(100296819) defensin, beta 114
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001037499 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001037499 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001037499 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037499 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037499 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308305 predicted 166
2 SASI_Hs01_00085724 predicted 88
3 SASI_Hs01_00085725 predicted 54
4 SASI_Hs01_00085726 predicted 138
5 SASI_Hs01_00085727 predicted 91
6 SASI_Hs01_00085728 predicted 65
7 SASI_Hs01_00085729 predicted 78
8 SASI_Hs01_00085730 predicted 89
9 SASI_Hs01_00085731 predicted 84
10 SASI_Hs01_00085732 predicted 142
11 SASI_Hs01_00085723 predicted 57
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037499
DEFB114 MISSION shRNA Bacterial Glycerol Stock
defensin, beta 114
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037499.1-112s21c1
Sequence:CCGGAGAGACTGTCTTGAGAGTGAACTCGAGTTCACTCTCAAGACAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037499.1-79s21c1
Sequence:CCGGGATCGTTGCACCAAACGTTACCTCGAGGTAACGTTTGGTGCAACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037499.1-184s21c1
Sequence:CCGGTTGTATGAAGAAGATGATATGCTCGAGCATATCATCTTCTTCATACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037499.1-30s21c1
Sequence:CCGGGTGTTATGTGACCTTCATTCTCTCGAGAGAATGAAGGTCACATAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037499.1-56s21c1
Sequence:CCGGCCACATGTACCTTGGTGAATGCTCGAGCATTCACCAAGGTACATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037499
DEFB114 MISSION shRNA shRNA Plasmid DNA
defensin, beta 114
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037499.1-112s21c1
Sequence:CCGGAGAGACTGTCTTGAGAGTGAACTCGAGTTCACTCTCAAGACAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037499.1-79s21c1
Sequence:CCGGGATCGTTGCACCAAACGTTACCTCGAGGTAACGTTTGGTGCAACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037499.1-184s21c1
Sequence:CCGGTTGTATGAAGAAGATGATATGCTCGAGCATATCATCTTCTTCATACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037499.1-30s21c1
Sequence:CCGGGTGTTATGTGACCTTCATTCTCTCGAGAGAATGAAGGTCACATAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037499.1-56s21c1
Sequence:CCGGCCACATGTACCTTGGTGAATGCTCGAGCATTCACCAAGGTACATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037499
DEFB114 MISSION shRNA Lentiviral Transduction Particles
defensin, beta 114
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037499.1-112s21c1
Sequence:CCGGAGAGACTGTCTTGAGAGTGAACTCGAGTTCACTCTCAAGACAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037499.1-79s21c1
Sequence:CCGGGATCGTTGCACCAAACGTTACCTCGAGGTAACGTTTGGTGCAACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037499.1-184s21c1
Sequence:CCGGTTGTATGAAGAAGATGATATGCTCGAGCATATCATCTTCTTCATACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037499.1-30s21c1
Sequence:CCGGGTGTTATGTGACCTTCATTCTCTCGAGAGAATGAAGGTCACATAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037499.1-56s21c1
Sequence:CCGGCCACATGTACCTTGGTGAATGCTCGAGCATTCACCAAGGTACATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks