EMAIL THIS PAGE TO A FRIEND

DEFB115

defensin, beta 115

19 Gene Product Result for
Synonyms: DEFB-15
Species: Human DEFB115(245929)
UniProtKB ID: Q30KQ5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001037730 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001037730 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001037730 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037730 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037730 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194064 predicted 35
2 SASI_Hs01_00194065 predicted 97
3 SASI_Hs01_00194066 predicted 187
4 SASI_Hs01_00194067 predicted 182
5 SASI_Hs02_00308351 predicted 214
6 SASI_Hs01_00194068 predicted 100
7 SASI_Hs01_00194071 predicted 184
8 SASI_Hs01_00194072 predicted 209
9 SASI_Hs02_00308352 predicted 114
10 SASI_Hs02_00308353 predicted 127
11 SASI_Hs01_00194063 predicted 46
12 SASI_Hs01_00194069 predicted 148
13 SASI_Hs01_00194070 predicted 97
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037730
DEFB115 MISSION shRNA Bacterial Glycerol Stock
defensin, beta 115
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037730.1-131s21c1
Sequence:CCGGGATGCAGGAAATCATGCAAAGCTCGAGCTTTGCATGATTTCCTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037730.1-221s21c1
Sequence:CCGGTATCACACATTCACGACCAAACTCGAGTTTGGTCGTGAATGTGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037730.1-99s21c1
Sequence:CCGGATGGATCAGAAGGTGCTATTACTCGAGTAATAGCACCTTCTGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037730.1-243s21c1
Sequence:CCGGAGAGACAAGTGAGCTATATATCTCGAGATATATAGCTCACTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037730.1-187s21c1
Sequence:CCGGCATATTTGCTGTGTCCCTAAACTCGAGTTTAGGGACACAGCAAATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037730
DEFB115 MISSION shRNA shRNA Plasmid DNA
defensin, beta 115
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037730.1-131s21c1
Sequence:CCGGGATGCAGGAAATCATGCAAAGCTCGAGCTTTGCATGATTTCCTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037730.1-221s21c1
Sequence:CCGGTATCACACATTCACGACCAAACTCGAGTTTGGTCGTGAATGTGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037730.1-99s21c1
Sequence:CCGGATGGATCAGAAGGTGCTATTACTCGAGTAATAGCACCTTCTGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037730.1-243s21c1
Sequence:CCGGAGAGACAAGTGAGCTATATATCTCGAGATATATAGCTCACTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037730.1-187s21c1
Sequence:CCGGCATATTTGCTGTGTCCCTAAACTCGAGTTTAGGGACACAGCAAATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037730
DEFB115 MISSION shRNA Lentiviral Transduction Particles
defensin, beta 115
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037730.1-131s21c1
Sequence:CCGGGATGCAGGAAATCATGCAAAGCTCGAGCTTTGCATGATTTCCTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037730.1-221s21c1
Sequence:CCGGTATCACACATTCACGACCAAACTCGAGTTTGGTCGTGAATGTGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037730.1-99s21c1
Sequence:CCGGATGGATCAGAAGGTGCTATTACTCGAGTAATAGCACCTTCTGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037730.1-243s21c1
Sequence:CCGGAGAGACAAGTGAGCTATATATCTCGAGATATATAGCTCACTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037730.1-187s21c1
Sequence:CCGGCATATTTGCTGTGTCCCTAAACTCGAGTTTAGGGACACAGCAAATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks