EMAIL THIS PAGE TO A FRIEND

DEFB116

defensin, beta 116

Synonyms: DEFB-16
UniProtKB ID: Q30KQ4
Gene ID:
cow(100296787) defensin, beta 116
domestic cat(101081970) defensin, beta 116
dog(100683674) defensin, beta 116
sheep(101110610) defensin, beta 116
domestic guinea pig(101787777) defensin, beta 116
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001037731 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001037731 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001037731 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037731 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037731 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124766 predicted 238
2 SASI_Hs02_00308354 predicted 146
3 SASI_Hs01_00124767 predicted 168
4 SASI_Hs01_00124768 predicted 243
5 SASI_Hs01_00124769 predicted 106
6 SASI_Hs01_00124771 predicted 254
7 SASI_Hs01_00124772 predicted 105
8 SASI_Hs01_00124773 predicted 114
9 SASI_Hs02_00308355 predicted 57
10 SASI_Hs02_00308356 predicted 268
11 SASI_Hs01_00124770 predicted 70
12 SASI_Hs01_00124774 predicted 112
13 SASI_Hs01_00124775 predicted 90
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037731
DEFB116 MISSION shRNA Bacterial Glycerol Stock
defensin, beta 116
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037731.1-109s21c1
Sequence:CCGGTGGAATCCATGTGAGCTTTACCTCGAGGTAAAGCTCACATGGATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037731.1-27s21c1
Sequence:CCGGGACCATTGCCATCCTTATGATCTCGAGATCATAAGGATGGCAATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037731.1-38s21c1
Sequence:CCGGTCCTTATGATCCTGGCTCAAACTCGAGTTTGAGCCAGGATCATAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037731.1-71s21c1
Sequence:CCGGGCCTGTTCAGATCCCACAATGCTCGAGCATTGTGGGATCTGAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037731.1-126s21c1
Sequence:CCGGTTACCAAGGCATGTGCAGAAACTCGAGTTTCTGCACATGCCTTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037731
DEFB116 MISSION shRNA shRNA Plasmid DNA
defensin, beta 116
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037731.1-109s21c1
Sequence:CCGGTGGAATCCATGTGAGCTTTACCTCGAGGTAAAGCTCACATGGATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037731.1-27s21c1
Sequence:CCGGGACCATTGCCATCCTTATGATCTCGAGATCATAAGGATGGCAATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037731.1-38s21c1
Sequence:CCGGTCCTTATGATCCTGGCTCAAACTCGAGTTTGAGCCAGGATCATAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037731.1-71s21c1
Sequence:CCGGGCCTGTTCAGATCCCACAATGCTCGAGCATTGTGGGATCTGAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037731.1-126s21c1
Sequence:CCGGTTACCAAGGCATGTGCAGAAACTCGAGTTTCTGCACATGCCTTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037731
DEFB116 MISSION shRNA Lentiviral Transduction Particles
defensin, beta 116
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037731.1-109s21c1
Sequence:CCGGTGGAATCCATGTGAGCTTTACCTCGAGGTAAAGCTCACATGGATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037731.1-27s21c1
Sequence:CCGGGACCATTGCCATCCTTATGATCTCGAGATCATAAGGATGGCAATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037731.1-38s21c1
Sequence:CCGGTCCTTATGATCCTGGCTCAAACTCGAGTTTGAGCCAGGATCATAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037731.1-71s21c1
Sequence:CCGGGCCTGTTCAGATCCCACAATGCTCGAGCATTGTGGGATCTGAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037731.1-126s21c1
Sequence:CCGGTTACCAAGGCATGTGCAGAAACTCGAGTTTCTGCACATGCCTTGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks