EMAIL THIS PAGE TO A FRIEND

DEFB118

defensin, beta 118

19 Gene Product Result for
Synonyms: C20orf63 DEFB-18 ESC42 ESP13.6
UniProtKB ID: Q96PH6, Q17RC4, Q8N691, Q9NUH0
Gene ID:
Human(117285) Summary: This gene encodes a member of the beta subfamily of defensins. Beta-defensins are antimicrobial peptides that protect tissues and organs from infection by a variety of microorganisms. Expression of this gene is regulated by androgen, and the encoded protein binds to sperm and exhibits antibacterial activity. This gene is found in a cluster with other beta-defensin genes on the long arm of chromosome 20. [provided by RefSeq, Dec 2010]
cow(100336211) defensin, beta 118
domestic guinea pig(101787756) defensin, beta 118
naked mole-rat(101718270) defensin, beta 118
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054112 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_054112 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_054112 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU004351 MISSION® esiRNA esiRNA targeting human DEFB118 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_054112 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054112 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123439 predicted 313
2 SASI_Hs01_00123440 predicted 312
3 SASI_Hs01_00123441 predicted 316
4 SASI_Hs01_00123442 predicted 358
5 SASI_Hs01_00123443 predicted 353
6 SASI_Hs01_00123444 predicted 314
7 SASI_Hs01_00123445 predicted 303
8 SASI_Hs01_00123446 predicted 361
9 SASI_Hs01_00123447 predicted 367
10 SASI_Hs01_00123448 predicted 424
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054112
DEFB118 MISSION shRNA Bacterial Glycerol Stock
defensin, beta 118
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054112.1-202s21c1
Sequence:CCGGATGAAGACCACAGGCGAGTTCCTCGAGGAACTCGCCTGTGGTCTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054112.1-327s21c1
Sequence:CCGGGATATGGTTGAAGAGTCTGAGCTCGAGCTCAGACTCTTCAACCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054112.1-364s21c1
Sequence:CCGGAGACCTCTCTTCCAAATGTTCCTCGAGGAACATTTGGAAGAGAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054112.1-175s21c1
Sequence:CCGGATCTTCGAGCTTGCTGCATTCCTCGAGGAATGCAGCAAGCTCGAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183532    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_054112.1-432s1c1
Sequence:CCGGGAGTGATAAACTAAGTCACATCTCGAGATGTGACTTAGTTTATCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180492    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054112.1-245s1c1
Sequence:CCGGGAGTGACTCAACACCAGGAATCTCGAGATTCCTGGTGTTGAGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054112.1-153s1c1
Sequence:CCGGGCAGTGAAAGATACATGCAAACTCGAGTTTGCATGTATCTTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054112.1-295s1c1
Sequence:CCGGCGACAGACTACTTTGAAGTAACTCGAGTTACTTCAAAGTAGTCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148966    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054112.1-425s1c1
Sequence:CCGGGTCCTCAGAGTGATAAACTAACTCGAGTTAGTTTATCACTCTGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054112.1-305s1c1
Sequence:CCGGCTTTGAAGTAAGCAGCAAGAACTCGAGTTCTTGCTGCTTACTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054112
DEFB118 MISSION shRNA shRNA Plasmid DNA
defensin, beta 118
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054112.1-202s21c1
Sequence:CCGGATGAAGACCACAGGCGAGTTCCTCGAGGAACTCGCCTGTGGTCTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054112.1-327s21c1
Sequence:CCGGGATATGGTTGAAGAGTCTGAGCTCGAGCTCAGACTCTTCAACCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054112.1-364s21c1
Sequence:CCGGAGACCTCTCTTCCAAATGTTCCTCGAGGAACATTTGGAAGAGAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054112.1-175s21c1
Sequence:CCGGATCTTCGAGCTTGCTGCATTCCTCGAGGAATGCAGCAAGCTCGAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183532    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_054112.1-432s1c1
Sequence:CCGGGAGTGATAAACTAAGTCACATCTCGAGATGTGACTTAGTTTATCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180492    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054112.1-245s1c1
Sequence:CCGGGAGTGACTCAACACCAGGAATCTCGAGATTCCTGGTGTTGAGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054112.1-153s1c1
Sequence:CCGGGCAGTGAAAGATACATGCAAACTCGAGTTTGCATGTATCTTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054112.1-295s1c1
Sequence:CCGGCGACAGACTACTTTGAAGTAACTCGAGTTACTTCAAAGTAGTCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148966    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054112.1-425s1c1
Sequence:CCGGGTCCTCAGAGTGATAAACTAACTCGAGTTAGTTTATCACTCTGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054112.1-305s1c1
Sequence:CCGGCTTTGAAGTAAGCAGCAAGAACTCGAGTTCTTGCTGCTTACTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054112
DEFB118 MISSION shRNA Lentiviral Transduction Particles
defensin, beta 118
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054112.1-202s21c1
Sequence:CCGGATGAAGACCACAGGCGAGTTCCTCGAGGAACTCGCCTGTGGTCTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054112.1-327s21c1
Sequence:CCGGGATATGGTTGAAGAGTCTGAGCTCGAGCTCAGACTCTTCAACCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054112.1-364s21c1
Sequence:CCGGAGACCTCTCTTCCAAATGTTCCTCGAGGAACATTTGGAAGAGAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054112.1-175s21c1
Sequence:CCGGATCTTCGAGCTTGCTGCATTCCTCGAGGAATGCAGCAAGCTCGAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183532    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_054112.1-432s1c1
Sequence:CCGGGAGTGATAAACTAAGTCACATCTCGAGATGTGACTTAGTTTATCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180492    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_054112.1-245s1c1
Sequence:CCGGGAGTGACTCAACACCAGGAATCTCGAGATTCCTGGTGTTGAGTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054112.1-153s1c1
Sequence:CCGGGCAGTGAAAGATACATGCAAACTCGAGTTTGCATGTATCTTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054112.1-295s1c1
Sequence:CCGGCGACAGACTACTTTGAAGTAACTCGAGTTACTTCAAAGTAGTCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148966    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054112.1-425s1c1
Sequence:CCGGGTCCTCAGAGTGATAAACTAACTCGAGTTAGTTTATCACTCTGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054112.1-305s1c1
Sequence:CCGGCTTTGAAGTAAGCAGCAAGAACTCGAGTTCTTGCTGCTTACTTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks