EMAIL THIS PAGE TO A FRIEND

DEFB119

defensin, beta 119

80 Gene Product Result for
Synonyms: DEFB-19 DEFB-20 DEFB120 ESC42-RELA ESC42-RELB
UniProtKB ID: Q8N690, Q5GRG1, Q5JWP1, Q5TH42, Q8N689
Gene ID:
Human(245932) Summary: This gene encodes a member of a family of small secreted proteins. These proteins participate in immune defense against microbial infection. This gene is located in a cluster of similar genes on chromosome 20. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2012]
naked mole-rat(101717384) defensin, beta 119
domestic guinea pig(100735126) defensin, beta 119
sheep(101123139) defensin, beta 119
domestic cat(101081718) defensin, beta 119
cow(100113474) defensin, beta 119
cow(767957) defensin, beta 119
dog(100683811) defensin, beta 119
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153323 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153323 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153323 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153289 Rosetta Predictions human pricing
NM_153323 Rosetta Predictions human pricing
NM_173460 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153289 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114062 predicted 211
2 SASI_Hs01_00114063 predicted 206
3 SASI_Hs01_00114064 predicted 197
4 SASI_Hs01_00114067 predicted 216
5 SASI_Hs01_00114065 predicted 204
6 SASI_Hs01_00114066 predicted 201
7 SASI_Hs01_00114068 predicted 386
8 SASI_Hs02_00367164 predicted 183
9 SASI_Hs01_00114069 predicted 152
10 SASI_Hs01_00114070 predicted 239
11 SASI_Hs01_00114071 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153323 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174329 predicted 197
2 SASI_Hs01_00174330 predicted 196
3 SASI_Hs01_00174331 predicted 198
4 SASI_Hs01_00174332 predicted 200
5 SASI_Hs01_00174333 predicted 205
6 SASI_Hs01_00174334 predicted 200
7 SASI_Hs01_00174335 predicted 257
8 SASI_Hs01_00174336 predicted 158
9 SASI_Hs02_00367173 predicted 376
10 SASI_Hs01_00174337 predicted 239
11 SASI_Hs01_00174338 predicted 232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173460 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151342 predicted 253
2 SASI_Hs01_00151343 predicted 222
3 SASI_Hs01_00151344 predicted 225
4 SASI_Hs01_00151346 predicted 232
5 SASI_Hs01_00151347 predicted 246
6 SASI_Hs01_00151348 predicted 212
7 SASI_Hs01_00151349 predicted 242
8 SASI_Hs01_00151350 predicted 218
9 SASI_Hs01_00151351 predicted 237
10 SASI_Hs02_00368198 predicted 253
11 SASI_Hs01_00151345 predicted 201
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153323
DEFB119 MISSION shRNA Bacterial Glycerol Stock
defensin, beta 119
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153323.3-240s1c1
Sequence:CCGGCATACGCTGCCGAAATCGTAACTCGAGTTACGATTTCGGCAGCGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153323.3-219s1c1
Sequence:CCGGCAAAGATGGTGAAGACAGCATCTCGAGATGCTGTCTTCACCATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153323.3-174s1c1
Sequence:CCGGGATATCAGTAGAGTGTTGGATCTCGAGATCCAACACTCTACTGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153323.3-223s1c1
Sequence:CCGGGATGGTGAAGACAGCATCATACTCGAGTATGATGCTGTCTTCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153323.3-218s1c1
Sequence:CCGGGCAAAGATGGTGAAGACAGCACTCGAGTGCTGTCTTCACCATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153323.3-295s1c1
Sequence:CCGGCAACCAGTAACAATTCATGGACTCGAGTCCATGAATTGTTACTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153323.3-163s1c1
Sequence:CCGGGAAGAACCAGTGATATCAGTACTCGAGTACTGATATCACTGGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153323.3-158s1c1
Sequence:CCGGCCATAGAAGAACCAGTGATATCTCGAGATATCACTGGTTCTTCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153323.3-278s21c1
Sequence:CCGGGTCGTTATTTAACAATCCAACCTCGAGGTTGGATTGTTAAATAACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153323.3-197s21c1
Sequence:CCGGATGGACACTGCCGGTTGTTGTCTCGAGACAACAACCGGCAGTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153323.3-267s21c1
Sequence:CCGGCTGTGTTCCTAGTCGTTATTTCTCGAGAAATAACGACTAGGAACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153323
DEFB119 MISSION shRNA shRNA Plasmid DNA
defensin, beta 119
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153323.3-240s1c1
Sequence:CCGGCATACGCTGCCGAAATCGTAACTCGAGTTACGATTTCGGCAGCGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153323.3-219s1c1
Sequence:CCGGCAAAGATGGTGAAGACAGCATCTCGAGATGCTGTCTTCACCATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153323.3-174s1c1
Sequence:CCGGGATATCAGTAGAGTGTTGGATCTCGAGATCCAACACTCTACTGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153323.3-223s1c1
Sequence:CCGGGATGGTGAAGACAGCATCATACTCGAGTATGATGCTGTCTTCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153323.3-218s1c1
Sequence:CCGGGCAAAGATGGTGAAGACAGCACTCGAGTGCTGTCTTCACCATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153323.3-295s1c1
Sequence:CCGGCAACCAGTAACAATTCATGGACTCGAGTCCATGAATTGTTACTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153323.3-163s1c1
Sequence:CCGGGAAGAACCAGTGATATCAGTACTCGAGTACTGATATCACTGGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153323.3-158s1c1
Sequence:CCGGCCATAGAAGAACCAGTGATATCTCGAGATATCACTGGTTCTTCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153323.3-278s21c1
Sequence:CCGGGTCGTTATTTAACAATCCAACCTCGAGGTTGGATTGTTAAATAACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153323.3-197s21c1
Sequence:CCGGATGGACACTGCCGGTTGTTGTCTCGAGACAACAACCGGCAGTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153323.3-267s21c1
Sequence:CCGGCTGTGTTCCTAGTCGTTATTTCTCGAGAAATAACGACTAGGAACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153323
DEFB119 MISSION shRNA Lentiviral Transduction Particles
defensin, beta 119
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153323.3-240s1c1
Sequence:CCGGCATACGCTGCCGAAATCGTAACTCGAGTTACGATTTCGGCAGCGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135342    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153323.3-219s1c1
Sequence:CCGGCAAAGATGGTGAAGACAGCATCTCGAGATGCTGTCTTCACCATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153323.3-174s1c1
Sequence:CCGGGATATCAGTAGAGTGTTGGATCTCGAGATCCAACACTCTACTGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153323.3-223s1c1
Sequence:CCGGGATGGTGAAGACAGCATCATACTCGAGTATGATGCTGTCTTCACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153323.3-218s1c1
Sequence:CCGGGCAAAGATGGTGAAGACAGCACTCGAGTGCTGTCTTCACCATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153323.3-295s1c1
Sequence:CCGGCAACCAGTAACAATTCATGGACTCGAGTCCATGAATTGTTACTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153323.3-163s1c1
Sequence:CCGGGAAGAACCAGTGATATCAGTACTCGAGTACTGATATCACTGGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153323.3-158s1c1
Sequence:CCGGCCATAGAAGAACCAGTGATATCTCGAGATATCACTGGTTCTTCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153323.3-278s21c1
Sequence:CCGGGTCGTTATTTAACAATCCAACCTCGAGGTTGGATTGTTAAATAACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153323.3-197s21c1
Sequence:CCGGATGGACACTGCCGGTTGTTGTCTCGAGACAACAACCGGCAGTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153323.3-267s21c1
Sequence:CCGGCTGTGTTCCTAGTCGTTATTTCTCGAGAAATAACGACTAGGAACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks