EMAIL THIS PAGE TO A FRIEND

DEFB121

defensin, beta 121

17 Gene Product Result for
Synonyms: ESC42RELC
UniProtKB ID: Q5J5C9, A1L4N1
Gene ID:
domestic guinea pig(101787698) defensin, beta 121
cow(100851268) defensin, beta 121
domestic cat(101087984) defensin, beta 121
dog(100683886) defensin, beta 121
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001011878 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001011878 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001011878 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011878 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011878 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306042 predicted 223
2 SASI_Hs02_00306043 predicted 191
3 SASI_Hs01_00223423 predicted 114
4 SASI_Hs01_00223424 predicted 227
5 SASI_Hs01_00223426 predicted 131
6 SASI_Hs01_00223427 predicted 239
7 SASI_Hs02_00306044 predicted 116
8 SASI_Hs01_00223428 predicted 142
9 SASI_Hs01_00223429 predicted 114
10 SASI_Hs01_00223432 predicted 191
11 SASI_Hs01_00223425 predicted 155
12 SASI_Hs01_00223430 predicted 182
13 SASI_Hs01_00223431 predicted 179
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001011878
DEFB121 MISSION shRNA Bacterial Glycerol Stock
defensin, beta 121
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011878.1-136s21c1
Sequence:CCGGTGTAAAGAAAGTGAAGTATACCTCGAGGTATACTTCACTTTCTTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011878.1-184s21c1
Sequence:CCGGTGCTGTGTGGATCCCAAGTATCTCGAGATACTTGGGATCCACACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011878.1-238s21c1
Sequence:CCGGACAAGCCTGGAATCAACTTCTCTCGAGAGAAGTTGATTCCAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011878.1-121s21c1
Sequence:CCGGAGGTGCAGAACAACATGTAAACTCGAGTTTACATGTTGTTCTGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011878.1-195s21c1
Sequence:CCGGTCCCAAGTATGTACCTGTAAACTCGAGTTTACAGGTACATACTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001011878
DEFB121 MISSION shRNA shRNA Plasmid DNA
defensin, beta 121
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011878.1-136s21c1
Sequence:CCGGTGTAAAGAAAGTGAAGTATACCTCGAGGTATACTTCACTTTCTTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011878.1-184s21c1
Sequence:CCGGTGCTGTGTGGATCCCAAGTATCTCGAGATACTTGGGATCCACACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011878.1-238s21c1
Sequence:CCGGACAAGCCTGGAATCAACTTCTCTCGAGAGAAGTTGATTCCAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011878.1-121s21c1
Sequence:CCGGAGGTGCAGAACAACATGTAAACTCGAGTTTACATGTTGTTCTGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011878.1-195s21c1
Sequence:CCGGTCCCAAGTATGTACCTGTAAACTCGAGTTTACAGGTACATACTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001011878
DEFB121 MISSION shRNA Lentiviral Transduction Particles
defensin, beta 121
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011878.1-136s21c1
Sequence:CCGGTGTAAAGAAAGTGAAGTATACCTCGAGGTATACTTCACTTTCTTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011878.1-184s21c1
Sequence:CCGGTGCTGTGTGGATCCCAAGTATCTCGAGATACTTGGGATCCACACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011878.1-238s21c1
Sequence:CCGGACAAGCCTGGAATCAACTTCTCTCGAGAGAAGTTGATTCCAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011878.1-121s21c1
Sequence:CCGGAGGTGCAGAACAACATGTAAACTCGAGTTTACATGTTGTTCTGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011878.1-195s21c1
Sequence:CCGGTCCCAAGTATGTACCTGTAAACTCGAGTTTACAGGTACATACTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks