EMAIL THIS PAGE TO A FRIEND

DEFB123

defensin, beta 123

22 Gene Product Result for
Synonyms: DEFB-23 ESC42-RELD
UniProtKB ID: Q8N688
Gene ID:
Human(245936) Summary: Defensins are cysteine-rich cationic polypeptides that are important in the host immunologic response to invading microorganisms. The protein encoded by this gene is secreted and is a member of the beta defensin protein family. Beta defensin genes are found in several clusters throughout the genome, with this gene mapping to a cluster at 20q11.1. [provided by RefSeq, Jul 2008]
dog(100684036) defensin, beta 123
cow(786992) defensin, beta 123
domestic cat(101087469) defensin, beta 123
sheep(101123652) defensin, beta 123
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153324 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153324 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153324 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU057361 MISSION® esiRNA esiRNA human DEFB123 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153324 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153324 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239882 predicted 208
2 SASI_Hs01_00239883 predicted 150
3 SASI_Hs01_00239884 predicted 344
4 SASI_Hs01_00239885 predicted 163
5 SASI_Hs01_00239886 predicted 340
6 SASI_Hs01_00239887 predicted 211
7 SASI_Hs01_00239888 predicted 134
8 SASI_Hs01_00239890 predicted 121
9 SASI_Hs01_00239891 predicted 331
10 SASI_Hs02_00367174 predicted 213
11 SASI_Hs01_00239889 predicted 157
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153324
DEFB123 MISSION shRNA Bacterial Glycerol Stock
defensin, beta 123
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153324.2-193s1c1
Sequence:CCGGCAGATGCTCCAAGAAGGAAAGCTCGAGCTTTCCTTCTTGGAGCATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153324.2-201s1c1
Sequence:CCGGCCAAGAAGGAAAGAGTCTATGCTCGAGCATAGACTCTTTCCTTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153324.2-165s1c1
Sequence:CCGGGCTGGAATCTTTATGGCAAATCTCGAGATTTGCCATAAAGATTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153324.2-202s1c1
Sequence:CCGGCAAGAAGGAAAGAGTCTATGTCTCGAGACATAGACTCTTTCCTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153324.2-157s1c1
Sequence:CCGGCCAAAGATGCTGGAATCTTTACTCGAGTAAAGATTCCAGCATCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153324.2-162s1c1
Sequence:CCGGGATGCTGGAATCTTTATGGCACTCGAGTGCCATAAAGATTCCAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153324.2-156s1c1
Sequence:CCGGCCCAAAGATGCTGGAATCTTTCTCGAGAAAGATTCCAGCATCTTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153324.2-180s1c1
Sequence:CCGGGCAAATGCCGTTACAGATGCTCTCGAGAGCATCTGTAACGGCATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153324
DEFB123 MISSION shRNA shRNA Plasmid DNA
defensin, beta 123
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153324.2-193s1c1
Sequence:CCGGCAGATGCTCCAAGAAGGAAAGCTCGAGCTTTCCTTCTTGGAGCATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153324.2-201s1c1
Sequence:CCGGCCAAGAAGGAAAGAGTCTATGCTCGAGCATAGACTCTTTCCTTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153324.2-165s1c1
Sequence:CCGGGCTGGAATCTTTATGGCAAATCTCGAGATTTGCCATAAAGATTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153324.2-202s1c1
Sequence:CCGGCAAGAAGGAAAGAGTCTATGTCTCGAGACATAGACTCTTTCCTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153324.2-157s1c1
Sequence:CCGGCCAAAGATGCTGGAATCTTTACTCGAGTAAAGATTCCAGCATCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153324.2-162s1c1
Sequence:CCGGGATGCTGGAATCTTTATGGCACTCGAGTGCCATAAAGATTCCAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153324.2-156s1c1
Sequence:CCGGCCCAAAGATGCTGGAATCTTTCTCGAGAAAGATTCCAGCATCTTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153324.2-180s1c1
Sequence:CCGGGCAAATGCCGTTACAGATGCTCTCGAGAGCATCTGTAACGGCATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153324
DEFB123 MISSION shRNA Lentiviral Transduction Particles
defensin, beta 123
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153324.2-193s1c1
Sequence:CCGGCAGATGCTCCAAGAAGGAAAGCTCGAGCTTTCCTTCTTGGAGCATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153324.2-201s1c1
Sequence:CCGGCCAAGAAGGAAAGAGTCTATGCTCGAGCATAGACTCTTTCCTTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153324.2-165s1c1
Sequence:CCGGGCTGGAATCTTTATGGCAAATCTCGAGATTTGCCATAAAGATTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151854    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153324.2-202s1c1
Sequence:CCGGCAAGAAGGAAAGAGTCTATGTCTCGAGACATAGACTCTTTCCTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153324.2-157s1c1
Sequence:CCGGCCAAAGATGCTGGAATCTTTACTCGAGTAAAGATTCCAGCATCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153324.2-162s1c1
Sequence:CCGGGATGCTGGAATCTTTATGGCACTCGAGTGCCATAAAGATTCCAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153324.2-156s1c1
Sequence:CCGGCCCAAAGATGCTGGAATCTTTCTCGAGAAAGATTCCAGCATCTTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153324.2-180s1c1
Sequence:CCGGGCAAATGCCGTTACAGATGCTCTCGAGAGCATCTGTAACGGCATTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)