EMAIL THIS PAGE TO A FRIEND

DEFB124

defensin, beta 124

15 Gene Product Result for
Synonyms: DEFB-24
UniProtKB ID: Q8NES8, Q30E74
Gene ID:
sheep(101102080) defensin, beta 124
domestic cat(101081460) defensin, beta 124
cow(100113475) defensin, beta 124
dog(100135058) defensin, beta 124
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001037500 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001037500 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001037500 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037500 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037500 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152543 predicted 53
2 SASI_Hs01_00152544 predicted 48
3 SASI_Hs01_00152545 predicted 149
4 SASI_Hs01_00152546 predicted 145
5 SASI_Hs01_00152547 predicted 87
6 SASI_Hs01_00152548 predicted 110
7 SASI_Hs01_00152549 predicted 98
8 SASI_Hs01_00152550 predicted 107
9 SASI_Hs01_00152551 predicted 46
10 SASI_Hs02_00308306 predicted 164
11 SASI_Hs01_00152552 predicted 105
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037500
DEFB124 MISSION shRNA Bacterial Glycerol Stock
defensin, beta 124
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037500.1-30s21c1
Sequence:CCGGTCTCCTGGTTCTGGGTCATGTCTCGAGACATGACCCAGAACCAGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037500.1-196s21c1
Sequence:CCGGCCCAAGCATGAATATGAGTAGCTCGAGCTACTCATATTCATGCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037500.1-164s21c1
Sequence:CCGGGTCTCTCCTATGCATTGAAACCTCGAGGTTTCAATGCATAGGAGAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037500.1-50s21c1
Sequence:CCGGTGCCATCAGGGAGAAGTGAATCTCGAGATTCACTTCTCCCTGATGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037500.1-108s21c1
Sequence:CCGGTTACTGCACAAGGCAAGAAACCTCGAGGTTTCTTGCCTTGTGCAGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037500
DEFB124 MISSION shRNA shRNA Plasmid DNA
defensin, beta 124
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037500.1-30s21c1
Sequence:CCGGTCTCCTGGTTCTGGGTCATGTCTCGAGACATGACCCAGAACCAGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037500.1-196s21c1
Sequence:CCGGCCCAAGCATGAATATGAGTAGCTCGAGCTACTCATATTCATGCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037500.1-164s21c1
Sequence:CCGGGTCTCTCCTATGCATTGAAACCTCGAGGTTTCAATGCATAGGAGAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037500.1-50s21c1
Sequence:CCGGTGCCATCAGGGAGAAGTGAATCTCGAGATTCACTTCTCCCTGATGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037500.1-108s21c1
Sequence:CCGGTTACTGCACAAGGCAAGAAACCTCGAGGTTTCTTGCCTTGTGCAGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037500
DEFB124 MISSION shRNA Lentiviral Transduction Particles
defensin, beta 124
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037500.1-30s21c1
Sequence:CCGGTCTCCTGGTTCTGGGTCATGTCTCGAGACATGACCCAGAACCAGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037500.1-196s21c1
Sequence:CCGGCCCAAGCATGAATATGAGTAGCTCGAGCTACTCATATTCATGCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037500.1-164s21c1
Sequence:CCGGGTCTCTCCTATGCATTGAAACCTCGAGGTTTCAATGCATAGGAGAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037500.1-50s21c1
Sequence:CCGGTGCCATCAGGGAGAAGTGAATCTCGAGATTCACTTCTCCCTGATGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037500.1-108s21c1
Sequence:CCGGTTACTGCACAAGGCAAGAAACCTCGAGGTTTCTTGCCTTGTGCAGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)