EMAIL THIS PAGE TO A FRIEND

DEFB125

defensin, beta 125

28 Gene Product Result for
Synonyms: DEFB-25
UniProtKB ID: Q8N687, A1A502, Q7Z7B9
Gene ID:
Human(245938) Summary: Defensins are cysteine-rich cationic polypeptides that are important in the host immunologic response to invading microorganisms. The protein encoded by this gene is secreted and is a member of the beta defensin protein family. Beta defensin genes are found in several clusters throughout the genome, with this gene mapping to a cluster at 20p13. [provided by RefSeq, Jul 2008]
domestic cat(101088480) defensin, beta 125
dog(100683603) defensin, beta 125
domestic guinea pig(101787808) defensin, beta 125
naked mole-rat(101715999) defensin, beta 125
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153325 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153325 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153325 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153325 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122238 predicted 442
2 SASI_Hs01_00122239 predicted 270
3 SASI_Hs01_00122240 predicted 414
4 SASI_Hs01_00122241 predicted 447
5 SASI_Hs01_00122242 predicted 286
6 SASI_Hs02_00367175 predicted 206
7 SASI_Hs01_00122244 predicted 314
8 SASI_Hs01_00122246 predicted 217
9 SASI_Hs01_00122247 predicted 369
10 SASI_Hs02_00367176 predicted 406
11 SASI_Hs01_00122243 predicted 295
12 SASI_Hs01_00122245 predicted 343
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153325
DEFB125 MISSION shRNA Bacterial Glycerol Stock
defensin, beta 125
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153325.2-38s21c1
Sequence:CCGGTGCTAACTCGGGTGACCAAAGCTCGAGCTTTGGTCACCCGAGTTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220033    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153325.2-486s1c1
Sequence:CCGGTGGTATGGAACAACTAGAAATCTCGAGATTTCTAGTTGTTCCATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153325.2-382s1c1
Sequence:CCGGACTACTCCCGAGACTACTATGCTCGAGCATAGTAGTCTCGGGAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153325.2-281s21c1
Sequence:CCGGCTATGTTGAATGATCTGATAACTCGAGTTATCAGATCATTCAACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153325.2-345s21c1
Sequence:CCGGCAATACTCCTGAGACTACTATCTCGAGATAGTAGTCTCAGGAGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435471    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153325.2-532s21c1
Sequence:CCGGCTGATTCTACCAATCCAATTTCTCGAGAAATTGGATTGGTAGAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153325.1-127s1c1
Sequence:CCGGCTTCTTTGTAGGAACAAGCTACTCGAGTAGCTTGTTCCTACAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153325.1-88s1c1
Sequence:CCGGCATTGCAGAAGACGATGTTTACTCGAGTAAACATCGTCTTCTGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153325.1-211s1c1
Sequence:CCGGCTAGAGGATATAACATTGGATCTCGAGATCCAATGTTATATCCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153325
DEFB125 MISSION shRNA shRNA Plasmid DNA
defensin, beta 125
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153325.2-38s21c1
Sequence:CCGGTGCTAACTCGGGTGACCAAAGCTCGAGCTTTGGTCACCCGAGTTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220033    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153325.2-486s1c1
Sequence:CCGGTGGTATGGAACAACTAGAAATCTCGAGATTTCTAGTTGTTCCATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153325.2-382s1c1
Sequence:CCGGACTACTCCCGAGACTACTATGCTCGAGCATAGTAGTCTCGGGAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153325.2-281s21c1
Sequence:CCGGCTATGTTGAATGATCTGATAACTCGAGTTATCAGATCATTCAACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153325.2-345s21c1
Sequence:CCGGCAATACTCCTGAGACTACTATCTCGAGATAGTAGTCTCAGGAGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435471    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153325.2-532s21c1
Sequence:CCGGCTGATTCTACCAATCCAATTTCTCGAGAAATTGGATTGGTAGAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153325.1-127s1c1
Sequence:CCGGCTTCTTTGTAGGAACAAGCTACTCGAGTAGCTTGTTCCTACAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153325.1-88s1c1
Sequence:CCGGCATTGCAGAAGACGATGTTTACTCGAGTAAACATCGTCTTCTGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153325.1-211s1c1
Sequence:CCGGCTAGAGGATATAACATTGGATCTCGAGATCCAATGTTATATCCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153325
DEFB125 MISSION shRNA Lentiviral Transduction Particles
defensin, beta 125
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153325.2-38s21c1
Sequence:CCGGTGCTAACTCGGGTGACCAAAGCTCGAGCTTTGGTCACCCGAGTTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220033    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153325.2-486s1c1
Sequence:CCGGTGGTATGGAACAACTAGAAATCTCGAGATTTCTAGTTGTTCCATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153325.2-382s1c1
Sequence:CCGGACTACTCCCGAGACTACTATGCTCGAGCATAGTAGTCTCGGGAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153325.2-281s21c1
Sequence:CCGGCTATGTTGAATGATCTGATAACTCGAGTTATCAGATCATTCAACATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153325.2-345s21c1
Sequence:CCGGCAATACTCCTGAGACTACTATCTCGAGATAGTAGTCTCAGGAGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435471    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153325.2-532s21c1
Sequence:CCGGCTGATTCTACCAATCCAATTTCTCGAGAAATTGGATTGGTAGAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153325.1-127s1c1
Sequence:CCGGCTTCTTTGTAGGAACAAGCTACTCGAGTAGCTTGTTCCTACAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153325.1-88s1c1
Sequence:CCGGCATTGCAGAAGACGATGTTTACTCGAGTAAACATCGTCTTCTGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153325.1-211s1c1
Sequence:CCGGCTAGAGGATATAACATTGGATCTCGAGATCCAATGTTATATCCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks