EMAIL THIS PAGE TO A FRIEND

DEFB126

defensin, beta 126

20 Gene Product Result for
Synonyms: C20orf8 DEFB-26 DEFB26 bA530N10.1 hBD-26
UniProtKB ID: Q9BYW3, Q562G3, Q9H1M5
Gene ID:
Human(81623) Summary: Defensins are cysteine-rich cationic polypeptides that are important in the immunologic response to invading microorganisms. The protein encoded by this gene is secreted and is a member of the beta defensin protein family. Beta defensin genes are found in several clusters throughout the genome, with this gene mapping to a cluster at 20p13. The encoded protein is highly similar to an epididymal-specific secretory protein (ESP13.2) from cynomolgus monkey. [provided by RefSeq, Jul 2008]
dog(100683529) defensin, beta 126
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030931 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030931 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030931 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030931 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030931 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127857 predicted 90
2 SASI_Hs01_00127858 predicted 156
3 SASI_Hs01_00127859 predicted 92
4 SASI_Hs01_00127860 predicted 24
5 SASI_Hs01_00127861 predicted 168
6 SASI_Hs01_00127862 predicted 206
7 SASI_Hs02_00358491 predicted 199
8 SASI_Hs02_00358492 predicted 200
9 SASI_Hs01_00127864 predicted 192
10 SASI_Hs01_00127866 predicted 18
11 SASI_Hs01_00127863 predicted 61
12 SASI_Hs01_00127865 predicted 133
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030931
DEFB126 MISSION shRNA Bacterial Glycerol Stock
defensin, beta 126
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030931.2-237s1c1
Sequence:CCGGCCAGACAAAGACTACAAGAATCTCGAGATTCTTGTAGTCTTTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030931.2-126s1c1
Sequence:CCGGGAAGTGCAAACCTGAAGAGATCTCGAGATCTCTTCAGGTTTGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030931.2-263s1c1
Sequence:CCGGCAGTAACAGCAACAACAGCAACTCGAGTTGCTGTTGTTGCTGTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030931.2-120s1c1
Sequence:CCGGCAAGAAGAAGTGCAAACCTGACTCGAGTCAGGTTTGCACTTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030931.2-200s1c1
Sequence:CCGGCAGCTGACAGACGTGCTAATTCTCGAGAATTAGCACGTCTGTCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030931.2-173s1c1
Sequence:CCGGGCGGCAAACAAAGGGACTGCTCTCGAGAGCAGTCCCTTTGTTTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030931
DEFB126 MISSION shRNA shRNA Plasmid DNA
defensin, beta 126
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030931.2-237s1c1
Sequence:CCGGCCAGACAAAGACTACAAGAATCTCGAGATTCTTGTAGTCTTTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030931.2-126s1c1
Sequence:CCGGGAAGTGCAAACCTGAAGAGATCTCGAGATCTCTTCAGGTTTGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030931.2-263s1c1
Sequence:CCGGCAGTAACAGCAACAACAGCAACTCGAGTTGCTGTTGTTGCTGTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030931.2-120s1c1
Sequence:CCGGCAAGAAGAAGTGCAAACCTGACTCGAGTCAGGTTTGCACTTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030931.2-200s1c1
Sequence:CCGGCAGCTGACAGACGTGCTAATTCTCGAGAATTAGCACGTCTGTCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030931.2-173s1c1
Sequence:CCGGGCGGCAAACAAAGGGACTGCTCTCGAGAGCAGTCCCTTTGTTTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030931
DEFB126 MISSION shRNA Lentiviral Transduction Particles
defensin, beta 126
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030931.2-237s1c1
Sequence:CCGGCCAGACAAAGACTACAAGAATCTCGAGATTCTTGTAGTCTTTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030931.2-126s1c1
Sequence:CCGGGAAGTGCAAACCTGAAGAGATCTCGAGATCTCTTCAGGTTTGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030931.2-263s1c1
Sequence:CCGGCAGTAACAGCAACAACAGCAACTCGAGTTGCTGTTGTTGCTGTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030931.2-120s1c1
Sequence:CCGGCAAGAAGAAGTGCAAACCTGACTCGAGTCAGGTTTGCACTTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030931.2-200s1c1
Sequence:CCGGCAGCTGACAGACGTGCTAATTCTCGAGAATTAGCACGTCTGTCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030931.2-173s1c1
Sequence:CCGGGCGGCAAACAAAGGGACTGCTCTCGAGAGCAGTCCCTTTGTTTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks