EMAIL THIS PAGE TO A FRIEND

DEFB127

defensin, beta 127

25 Gene Product Result for
Synonyms: C20orf73 DEF-27 DEFB-27 DEFB27 bA530N10.2 hBD-27
UniProtKB ID: Q9H1M4, Q14DW7
Gene ID:
Human(140850) Summary: Defensins are cysteine-rich cationic polypeptides that are important in the immunologic response to invading microorganisms. The protein encoded by this gene is secreted and is a member of the beta defensin protein family. Beta defensin genes are found in several clusters throughout the genome, with this gene mapping to a cluster at 20p13. [provided by RefSeq, Jul 2008]
dog(100135060) defensin, beta 127
domestic cat(101082226) defensin, beta 127
naked mole-rat(101727102) defensin, beta 127
domestic guinea pig(100735403) defensin, beta 127
sheep(101109293) defensin, beta 127
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139074 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139074 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139074 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139074 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139074 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205735 predicted 200
2 SASI_Hs01_00205736 predicted 210
3 SASI_Hs01_00205737 predicted 212
4 SASI_Hs01_00205738 predicted 208
5 SASI_Hs01_00205739 predicted 210
6 SASI_Hs01_00205740 predicted 204
7 SASI_Hs01_00205741 predicted 198
8 SASI_Hs01_00205742 predicted 19
9 SASI_Hs01_00205743 predicted 324
10 SASI_Hs01_00205744 predicted 103
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139074
DEFB127 MISSION shRNA Bacterial Glycerol Stock
defensin, beta 127
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139074.2-223s1c1
Sequence:CCGGGCAACACTTGCACTGACTCTTCTCGAGAAGAGTCAGTGCAAGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139074.2-58s1c1
Sequence:CCGGCAACTTAAGAAGTGCTGGAATCTCGAGATTCCAGCACTTCTTAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139074.2-85s1c1
Sequence:CCGGGTACAAGGACATTGCAGGAAACTCGAGTTTCCTGCAATGTCCTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139074.2-111s1c1
Sequence:CCGGCAGAGTAAATGAAGTGCCTGACTCGAGTCAGGCACTTCATTTACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139074.2-278s1c1
Sequence:CCGGGCCTGAAGACACAGTCTACATCTCGAGATGTAGACTGTGTCTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139074.2-43s1c1
Sequence:CCGGCCCACAGTAACCGAACAACTTCTCGAGAAGTTGTTCGGTTACTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139074.2-37s1c1
Sequence:CCGGCAGAAACCCACAGTAACCGAACTCGAGTTCGGTTACTGTGGGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139074.2-237s21c1
Sequence:CCGGGACTCTTCAAGACTATGTTACCTCGAGGTAACATAGTCTTGAAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139074.2-210s21c1
Sequence:CCGGTCGTCCAAAGCCAGCAACACTCTCGAGAGTGTTGCTGGCTTTGGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139074.2-150s21c1
Sequence:CCGGGAGATACTGTTGCCTCAATATCTCGAGATATTGAGGCAACAGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139074.2-60s21c1
Sequence:CCGGACTTAAGAAGTGCTGGAATAACTCGAGTTATTCCAGCACTTCTTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139074
DEFB127 MISSION shRNA shRNA Plasmid DNA
defensin, beta 127
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139074.2-223s1c1
Sequence:CCGGGCAACACTTGCACTGACTCTTCTCGAGAAGAGTCAGTGCAAGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139074.2-58s1c1
Sequence:CCGGCAACTTAAGAAGTGCTGGAATCTCGAGATTCCAGCACTTCTTAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139074.2-85s1c1
Sequence:CCGGGTACAAGGACATTGCAGGAAACTCGAGTTTCCTGCAATGTCCTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139074.2-111s1c1
Sequence:CCGGCAGAGTAAATGAAGTGCCTGACTCGAGTCAGGCACTTCATTTACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139074.2-278s1c1
Sequence:CCGGGCCTGAAGACACAGTCTACATCTCGAGATGTAGACTGTGTCTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139074.2-43s1c1
Sequence:CCGGCCCACAGTAACCGAACAACTTCTCGAGAAGTTGTTCGGTTACTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139074.2-37s1c1
Sequence:CCGGCAGAAACCCACAGTAACCGAACTCGAGTTCGGTTACTGTGGGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139074.2-237s21c1
Sequence:CCGGGACTCTTCAAGACTATGTTACCTCGAGGTAACATAGTCTTGAAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139074.2-210s21c1
Sequence:CCGGTCGTCCAAAGCCAGCAACACTCTCGAGAGTGTTGCTGGCTTTGGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139074.2-150s21c1
Sequence:CCGGGAGATACTGTTGCCTCAATATCTCGAGATATTGAGGCAACAGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139074.2-60s21c1
Sequence:CCGGACTTAAGAAGTGCTGGAATAACTCGAGTTATTCCAGCACTTCTTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139074
DEFB127 MISSION shRNA Lentiviral Transduction Particles
defensin, beta 127
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139074.2-223s1c1
Sequence:CCGGGCAACACTTGCACTGACTCTTCTCGAGAAGAGTCAGTGCAAGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139074.2-58s1c1
Sequence:CCGGCAACTTAAGAAGTGCTGGAATCTCGAGATTCCAGCACTTCTTAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139074.2-85s1c1
Sequence:CCGGGTACAAGGACATTGCAGGAAACTCGAGTTTCCTGCAATGTCCTTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139074.2-111s1c1
Sequence:CCGGCAGAGTAAATGAAGTGCCTGACTCGAGTCAGGCACTTCATTTACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139074.2-278s1c1
Sequence:CCGGGCCTGAAGACACAGTCTACATCTCGAGATGTAGACTGTGTCTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139074.2-43s1c1
Sequence:CCGGCCCACAGTAACCGAACAACTTCTCGAGAAGTTGTTCGGTTACTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139074.2-37s1c1
Sequence:CCGGCAGAAACCCACAGTAACCGAACTCGAGTTCGGTTACTGTGGGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139074.2-237s21c1
Sequence:CCGGGACTCTTCAAGACTATGTTACCTCGAGGTAACATAGTCTTGAAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139074.2-210s21c1
Sequence:CCGGTCGTCCAAAGCCAGCAACACTCTCGAGAGTGTTGCTGGCTTTGGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139074.2-150s21c1
Sequence:CCGGGAGATACTGTTGCCTCAATATCTCGAGATATTGAGGCAACAGTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139074.2-60s21c1
Sequence:CCGGACTTAAGAAGTGCTGGAATAACTCGAGTTATTCCAGCACTTCTTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks