EMAIL THIS PAGE TO A FRIEND

DEFB128

defensin, beta 128

14 Gene Product Result for
Synonyms: DEFB-28 DEFB28 hBD-28
UniProtKB ID: Q7Z7B8, B2RU29
Gene ID:
naked mole-rat(101718623) defensin, beta 128
cow(100847860) defensin, beta 128
dog(100683301) defensin, beta 128
domestic cat(101089003) defensin, beta 128
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001037732 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001037732 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001037732 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037732 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037732 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111905 predicted 225
2 SASI_Hs01_00111906 predicted 181
3 SASI_Hs01_00111907 predicted 127
4 SASI_Hs01_00111908 predicted 228
5 SASI_Hs01_00111909 predicted 135
6 SASI_Hs01_00111910 predicted 114
7 SASI_Hs01_00111911 predicted 141
8 SASI_Hs01_00111912 predicted 193
9 SASI_Hs01_00111913 predicted 112
10 SASI_Hs02_00308357 predicted 22
11 SASI_Hs01_00111904 predicted 112
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037732
DEFB128 MISSION shRNA Bacterial Glycerol Stock
defensin, beta 128
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037732.1-226s21c1
Sequence:CCGGCTGAGTGTGCTGCAGGATTACCTCGAGGTAATCCTGCAGCACACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037732.1-195s21c1
Sequence:CCGGTAAGAAGCCACATCAACATTCCTCGAGGAATGTTGATGTGGCTTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037732.1-133s21c1
Sequence:CCGGGGATGTCTAAGTGGGAAATTACTCGAGTAATTTCCCACTTAGACATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037732.1-74s21c1
Sequence:CCGGTCAATAAAGTAACAGGCTATTCTCGAGAATAGCCTGTTACTTTATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037732.1-111s21c1
Sequence:CCGGGGTAGGAGAAAGATATGAAATCTCGAGATTTCATATCTTTCTCCTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037732
DEFB128 MISSION shRNA shRNA Plasmid DNA
defensin, beta 128
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037732.1-226s21c1
Sequence:CCGGCTGAGTGTGCTGCAGGATTACCTCGAGGTAATCCTGCAGCACACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037732.1-195s21c1
Sequence:CCGGTAAGAAGCCACATCAACATTCCTCGAGGAATGTTGATGTGGCTTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037732.1-133s21c1
Sequence:CCGGGGATGTCTAAGTGGGAAATTACTCGAGTAATTTCCCACTTAGACATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037732.1-74s21c1
Sequence:CCGGTCAATAAAGTAACAGGCTATTCTCGAGAATAGCCTGTTACTTTATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037732.1-111s21c1
Sequence:CCGGGGTAGGAGAAAGATATGAAATCTCGAGATTTCATATCTTTCTCCTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037732
DEFB128 MISSION shRNA Lentiviral Transduction Particles
defensin, beta 128
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037732.1-226s21c1
Sequence:CCGGCTGAGTGTGCTGCAGGATTACCTCGAGGTAATCCTGCAGCACACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037732.1-195s21c1
Sequence:CCGGTAAGAAGCCACATCAACATTCCTCGAGGAATGTTGATGTGGCTTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037732.1-133s21c1
Sequence:CCGGGGATGTCTAAGTGGGAAATTACTCGAGTAATTTCCCACTTAGACATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037732.1-74s21c1
Sequence:CCGGTCAATAAAGTAACAGGCTATTCTCGAGAATAGCCTGTTACTTTATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037732.1-111s21c1
Sequence:CCGGGGTAGGAGAAAGATATGAAATCTCGAGATTTCATATCTTTCTCCTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks