EMAIL THIS PAGE TO A FRIEND

DEFB129

defensin, beta 129

22 Gene Product Result for
Synonyms: C20orf87 DEFB-29 DEFB29 bA530N10.3 hBD-29
UniProtKB ID: Q9H1M3, Q8NES7
Gene ID:
Human(140881) Summary: Defensins are cysteine-rich cationic polypeptides that are important in the immunologic response to invading microorganisms. The protein encoded by this gene is secreted and is a member of the beta defensin protein family. Beta defensin genes are found in several clusters throughout the genome, with this gene mapping to a cluster at 20p13. [provided by RefSeq, Jul 2008]
domestic cat(101082482) defensin, beta 129
dog(100683229) defensin, beta 129
domestic guinea pig(100735682) defensin, beta 129
sheep(101109034) defensin, beta 129
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080831 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080831 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080831 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080831 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080831 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172756 predicted 266
2 SASI_Hs01_00172757 predicted 212
3 SASI_Hs01_00172758 predicted 425
4 SASI_Hs01_00172759 predicted 202
5 SASI_Hs01_00172760 predicted 260
6 SASI_Hs01_00172761 predicted 196
7 SASI_Hs01_00172762 predicted 207
8 SASI_Hs01_00172763 predicted 425
9 SASI_Hs01_00172764 predicted 417
10 SASI_Hs02_00362620 predicted 446
11 SASI_Hs01_00172765 predicted 207
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080831
DEFB129 MISSION shRNA Bacterial Glycerol Stock
defensin, beta 129
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080831.2-111s1c1
Sequence:CCGGGATCACTGCAATGTGGATGAACTCGAGTTCATCCACATTGCAGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080831.2-439s1c1
Sequence:CCGGCCAAGAGTAACACCAAAGAAACTCGAGTTTCTTTGGTGTTACTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080831.2-346s1c1
Sequence:CCGGCCAACTTTGTCATCATTCCAACTCGAGTTGGAATGATGACAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080831.2-225s1c1
Sequence:CCGGGTACTTAATGAAGACGTCCAACTCGAGTTGGACGTCTTCATTAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080831.2-206s1c1
Sequence:CCGGGCAATATGGAACACCAAATGTCTCGAGACATTTGGTGTTCCATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080831
DEFB129 MISSION shRNA shRNA Plasmid DNA
defensin, beta 129
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080831.2-111s1c1
Sequence:CCGGGATCACTGCAATGTGGATGAACTCGAGTTCATCCACATTGCAGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080831.2-439s1c1
Sequence:CCGGCCAAGAGTAACACCAAAGAAACTCGAGTTTCTTTGGTGTTACTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080831.2-346s1c1
Sequence:CCGGCCAACTTTGTCATCATTCCAACTCGAGTTGGAATGATGACAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080831.2-225s1c1
Sequence:CCGGGTACTTAATGAAGACGTCCAACTCGAGTTGGACGTCTTCATTAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080831.2-206s1c1
Sequence:CCGGGCAATATGGAACACCAAATGTCTCGAGACATTTGGTGTTCCATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080831
DEFB129 MISSION shRNA Lentiviral Transduction Particles
defensin, beta 129
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080831.2-111s1c1
Sequence:CCGGGATCACTGCAATGTGGATGAACTCGAGTTCATCCACATTGCAGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080831.2-439s1c1
Sequence:CCGGCCAAGAGTAACACCAAAGAAACTCGAGTTTCTTTGGTGTTACTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080831.2-346s1c1
Sequence:CCGGCCAACTTTGTCATCATTCCAACTCGAGTTGGAATGATGACAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080831.2-225s1c1
Sequence:CCGGGTACTTAATGAAGACGTCCAACTCGAGTTGGACGTCTTCATTAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080831.2-206s1c1
Sequence:CCGGGCAATATGGAACACCAAATGTCTCGAGACATTTGGTGTTCCATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks