EMAIL THIS PAGE TO A FRIEND

DEFB130

defensin, beta 130

14 Gene Product Result for
Synonyms: DEFB-30 DEFB130L
Species: Human DEFB130(245940)
UniProtKB ID: Q30KQ2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001037804 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001037804 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001037804 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037804 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037804 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109442 predicted 58
2 SASI_Hs01_00109443 predicted 31
3 SASI_Hs01_00109444 predicted 180
4 SASI_Hs01_00109445 predicted 116
5 SASI_Hs01_00109446 predicted 140
6 SASI_Hs01_00109447 predicted 121
7 SASI_Hs01_00109448 predicted 134
8 SASI_Hs02_00308369 predicted 144
9 SASI_Hs02_00308370 predicted 25
10 SASI_Hs01_00109450 predicted 139
11 SASI_Hs01_00109449 predicted 142
12 SASI_Hs01_00109451 predicted 112
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037804
DEFB130 MISSION shRNA Bacterial Glycerol Stock
defensin, beta 130
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037804.1-65s21c1
Sequence:CCGGCTGGCGTTATTCCAGGACAAACTCGAGTTTGTCCTGGAATAACGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037804.1-180s21c1
Sequence:CCGGTAGAAGGTGGTGGATACTTGACTCGAGTCAAGTATCCACCACCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037804.1-137s21c1
Sequence:CCGGTAGATGATACCATTGGTATATCTCGAGATATACCAATGGTATCATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037804.1-108s21c1
Sequence:CCGGGGTGTGCAGAGACAAACTATGCTCGAGCATAGTTTGTCTCTGCACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037804.1-205s21c1
Sequence:CCGGTATCCAACTCCGGTTCCCAAACTCGAGTTTGGGAACCGGAGTTGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037804
DEFB130 MISSION shRNA shRNA Plasmid DNA
defensin, beta 130
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037804.1-65s21c1
Sequence:CCGGCTGGCGTTATTCCAGGACAAACTCGAGTTTGTCCTGGAATAACGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037804.1-180s21c1
Sequence:CCGGTAGAAGGTGGTGGATACTTGACTCGAGTCAAGTATCCACCACCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037804.1-137s21c1
Sequence:CCGGTAGATGATACCATTGGTATATCTCGAGATATACCAATGGTATCATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037804.1-108s21c1
Sequence:CCGGGGTGTGCAGAGACAAACTATGCTCGAGCATAGTTTGTCTCTGCACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037804.1-205s21c1
Sequence:CCGGTATCCAACTCCGGTTCCCAAACTCGAGTTTGGGAACCGGAGTTGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037804
DEFB130 MISSION shRNA Lentiviral Transduction Particles
defensin, beta 130
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037804.1-65s21c1
Sequence:CCGGCTGGCGTTATTCCAGGACAAACTCGAGTTTGTCCTGGAATAACGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037804.1-180s21c1
Sequence:CCGGTAGAAGGTGGTGGATACTTGACTCGAGTCAAGTATCCACCACCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037804.1-137s21c1
Sequence:CCGGTAGATGATACCATTGGTATATCTCGAGATATACCAATGGTATCATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037804.1-108s21c1
Sequence:CCGGGGTGTGCAGAGACAAACTATGCTCGAGCATAGTTTGTCTCTGCACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001037804.1-205s21c1
Sequence:CCGGTATCCAACTCCGGTTCCCAAACTCGAGTTTGGGAACCGGAGTTGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks