EMAIL THIS PAGE TO A FRIEND

DEFB131

defensin, beta 131

13 Gene Product Result for
Synonyms: DEFB-31
Species: Human DEFB131(644414)
UniProtKB ID: P59861
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001040448 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001040448 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001040448 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040448 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040448 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229015 predicted 173
2 SASI_Hs01_00229017 predicted 159
3 SASI_Hs01_00229018 predicted 17
4 SASI_Hs01_00229019 predicted 61
5 SASI_Hs01_00229020 predicted 156
6 SASI_Hs01_00229021 predicted 161
7 SASI_Hs01_00229022 predicted 116
8 SASI_Hs01_00229023 predicted 60
9 SASI_Hs01_00229024 predicted 104
10 SASI_Hs02_00308986 predicted 53
11 SASI_Hs01_00229016 predicted 29
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040448
DEFB131 MISSION shRNA Bacterial Glycerol Stock
defensin, beta 131
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040448.2-122s21c1
Sequence:CCGGATGCTGATGAACATGCAATTACTCGAGTAATTGCATGTTCATCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040448.2-53s21c1
Sequence:CCGGCTCCAGCCAGAAGCTTCATTTCTCGAGAAATGAAGCTTCTGGCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040448.2-81s21c1
Sequence:CCGGTGAATGTCCTTCAGAATATTACTCGAGTAATATTCTGAAGGACATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040448.2-167s21c1
Sequence:CCGGGCTGCAAACTGAAGATCATTGCTCGAGCAATGATCTTCAGTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040448.2-29s21c1
Sequence:CCGGTCCTTTCCTTGATGTTCACAGCTCGAGCTGTGAACATCAAGGAAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040448
DEFB131 MISSION shRNA shRNA Plasmid DNA
defensin, beta 131
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040448.2-122s21c1
Sequence:CCGGATGCTGATGAACATGCAATTACTCGAGTAATTGCATGTTCATCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040448.2-53s21c1
Sequence:CCGGCTCCAGCCAGAAGCTTCATTTCTCGAGAAATGAAGCTTCTGGCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040448.2-81s21c1
Sequence:CCGGTGAATGTCCTTCAGAATATTACTCGAGTAATATTCTGAAGGACATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040448.2-167s21c1
Sequence:CCGGGCTGCAAACTGAAGATCATTGCTCGAGCAATGATCTTCAGTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040448.2-29s21c1
Sequence:CCGGTCCTTTCCTTGATGTTCACAGCTCGAGCTGTGAACATCAAGGAAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040448
DEFB131 MISSION shRNA Lentiviral Transduction Particles
defensin, beta 131
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256548    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040448.2-122s21c1
Sequence:CCGGATGCTGATGAACATGCAATTACTCGAGTAATTGCATGTTCATCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040448.2-53s21c1
Sequence:CCGGCTCCAGCCAGAAGCTTCATTTCTCGAGAAATGAAGCTTCTGGCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040448.2-81s21c1
Sequence:CCGGTGAATGTCCTTCAGAATATTACTCGAGTAATATTCTGAAGGACATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040448.2-167s21c1
Sequence:CCGGGCTGCAAACTGAAGATCATTGCTCGAGCAATGATCTTCAGTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040448.2-29s21c1
Sequence:CCGGTCCTTTCCTTGATGTTCACAGCTCGAGCTGTGAACATCAAGGAAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks