EMAIL THIS PAGE TO A FRIEND

DEFB134

defensin, beta 134

UniProtKB ID: Q4QY38, A1L4A4
Gene ID:
dog(100684368) defensin, beta 134
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033019 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001033019 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001033019 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU100581 MISSION® esiRNA esiRNA human AC107918.5-202 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033019 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033019 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051638 predicted 42
2 SASI_Hs01_00051639 predicted 35
3 SASI_Hs02_00307966 predicted 116
4 SASI_Hs01_00051640 predicted 54
5 SASI_Hs01_00051641 predicted 167
6 SASI_Hs01_00051644 predicted 119
7 SASI_Hs01_00051645 predicted 164
8 SASI_Hs01_00051646 predicted 42
9 SASI_Hs01_00051647 predicted 48
10 SASI_Hs02_00307967 predicted 135
11 SASI_Hs01_00051642 predicted 142
12 SASI_Hs01_00051643 predicted 108
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033019
DEFB134 MISSION shRNA Bacterial Glycerol Stock
defensin, beta 134
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033019.1-142s21c1
Sequence:CCGGTTAGTTGCCTACTGTATGTTTCTCGAGAAACATACAGTAGGCAACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033019.1-45s21c1
Sequence:CCGGTCCAGTGCTGGCAGGTATAAACTCGAGTTTATACCTGCCAGCACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033019.1-164s21c1
Sequence:CCGGAGCTGGAGTGCTGTGTCAAAGCTCGAGCTTTGACACAGCACTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033019.1-82s21c1
Sequence:CCGGATGCACAAGAAATGCTATAAACTCGAGTTTATAGCATTTCTTGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033019.1-120s21c1
Sequence:CCGGTGAATGCTATGAGAGTGAAATCTCGAGATTTCACTCTCATAGCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033019
DEFB134 MISSION shRNA shRNA Plasmid DNA
defensin, beta 134
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033019.1-142s21c1
Sequence:CCGGTTAGTTGCCTACTGTATGTTTCTCGAGAAACATACAGTAGGCAACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033019.1-45s21c1
Sequence:CCGGTCCAGTGCTGGCAGGTATAAACTCGAGTTTATACCTGCCAGCACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033019.1-164s21c1
Sequence:CCGGAGCTGGAGTGCTGTGTCAAAGCTCGAGCTTTGACACAGCACTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033019.1-82s21c1
Sequence:CCGGATGCACAAGAAATGCTATAAACTCGAGTTTATAGCATTTCTTGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033019.1-120s21c1
Sequence:CCGGTGAATGCTATGAGAGTGAAATCTCGAGATTTCACTCTCATAGCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033019
DEFB134 MISSION shRNA Lentiviral Transduction Particles
defensin, beta 134
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033019.1-142s21c1
Sequence:CCGGTTAGTTGCCTACTGTATGTTTCTCGAGAAACATACAGTAGGCAACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033019.1-45s21c1
Sequence:CCGGTCCAGTGCTGGCAGGTATAAACTCGAGTTTATACCTGCCAGCACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033019.1-164s21c1
Sequence:CCGGAGCTGGAGTGCTGTGTCAAAGCTCGAGCTTTGACACAGCACTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033019.1-82s21c1
Sequence:CCGGATGCACAAGAAATGCTATAAACTCGAGTTTATAGCATTTCTTGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033019.1-120s21c1
Sequence:CCGGTGAATGCTATGAGAGTGAAATCTCGAGATTTCACTCTCATAGCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks