EMAIL THIS PAGE TO A FRIEND

DEFB135

defensin, beta 135

16 Gene Product Result for
Synonyms: DEFB136
UniProtKB ID: Q30KP9, Q4QY37
Gene ID:
dog(100683933) defensin, beta 135
domestic guinea pig(100715377) defensin, beta 135
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033017 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001033017 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001033017 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033017 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033017 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218529 predicted 64
2 SASI_Hs01_00218530 predicted 33
3 SASI_Hs01_00218531 predicted 63
4 SASI_Hs01_00218532 predicted 74
5 SASI_Hs01_00218533 predicted 23
6 SASI_Hs01_00218534 predicted 21
7 SASI_Hs01_00218535 predicted 73
8 SASI_Hs01_00218537 predicted 23
9 SASI_Hs02_00307964 predicted 113
10 SASI_Hs02_00307965 predicted 164
11 SASI_Hs01_00218536 predicted 30
12 SASI_Hs01_00218538 predicted 51
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033017
DEFB135 MISSION shRNA Bacterial Glycerol Stock
defensin, beta 135
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033017.2-71s21c1
Sequence:CCGGGTGGACCCAATGTCTACATACCTCGAGGTATGTAGACATTGGGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033017.2-213s21c1
Sequence:CCGGACCTATACTGACTGGGAAATACTCGAGTATTTCCCAGTCAGTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033017.2-26s21c1
Sequence:CCGGCCCTCGTGGTCCTTAACTTACCTCGAGGTAAGTTAAGGACCACGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033017.2-169s21c1
Sequence:CCGGTTGTGTGATACTATACATTTGCTCGAGCAAATGTATAGTATCACACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033017.2-111s21c1
Sequence:CCGGTTGGCGACTGCAAGGTACTTGCTCGAGCAAGTACCTTGCAGTCGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033017
DEFB135 MISSION shRNA shRNA Plasmid DNA
defensin, beta 135
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033017.2-71s21c1
Sequence:CCGGGTGGACCCAATGTCTACATACCTCGAGGTATGTAGACATTGGGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033017.2-213s21c1
Sequence:CCGGACCTATACTGACTGGGAAATACTCGAGTATTTCCCAGTCAGTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033017.2-26s21c1
Sequence:CCGGCCCTCGTGGTCCTTAACTTACCTCGAGGTAAGTTAAGGACCACGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033017.2-169s21c1
Sequence:CCGGTTGTGTGATACTATACATTTGCTCGAGCAAATGTATAGTATCACACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033017.2-111s21c1
Sequence:CCGGTTGGCGACTGCAAGGTACTTGCTCGAGCAAGTACCTTGCAGTCGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033017
DEFB135 MISSION shRNA Lentiviral Transduction Particles
defensin, beta 135
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033017.2-71s21c1
Sequence:CCGGGTGGACCCAATGTCTACATACCTCGAGGTATGTAGACATTGGGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033017.2-213s21c1
Sequence:CCGGACCTATACTGACTGGGAAATACTCGAGTATTTCCCAGTCAGTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033017.2-26s21c1
Sequence:CCGGCCCTCGTGGTCCTTAACTTACCTCGAGGTAAGTTAAGGACCACGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033017.2-169s21c1
Sequence:CCGGTTGTGTGATACTATACATTTGCTCGAGCAAATGTATAGTATCACACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033017.2-111s21c1
Sequence:CCGGTTGGCGACTGCAAGGTACTTGCTCGAGCAAGTACCTTGCAGTCGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks