EMAIL THIS PAGE TO A FRIEND

DEFB1

defensin, beta 1

55 Gene Product Result for
Synonyms: BD1 DEFB-1 DEFB101 HBD1
UniProtKB ID: P60022, Q09753
Gene ID:
Human(1672) Summary: Defensins form a family of microbicidal and cytotoxic peptides made by neutrophils. Members of the defensin family are highly similar in protein sequence. This gene encodes defensin, beta 1, an antimicrobial peptide implicated in the resistance of epithelial surfaces to microbial colonization. This gene maps in close proximity to defensin family member, defensin, alpha 1 and has been implicated in the pathogenesis of cystic fibrosis. [provided by RefSeq, Jul 2008]
Mouse(13214) defensin beta 1
Rat(83687) defensin beta 1
chicken(395363) defensin, beta 1
cow(281743) defensin, beta 1
dog(611241) defensin, beta 1
naked mole-rat(101713234) defensin, beta 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301021 ANTI-DEFB1 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005218 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005218 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005218 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007843 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007843 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007843 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU057761 MISSION® esiRNA esiRNA human DEFB1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005218 Rosetta Predictions human pricing
NM_031810 Rosetta Predictions rat pricing
NM_007843 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005218 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236701 predicted 238
2 SASI_Hs01_00236702 predicted 232
3 SASI_Hs01_00236703 predicted 231
4 SASI_Hs01_00236704 predicted 229
5 SASI_Hs01_00236705 predicted 199
6 SASI_Hs01_00236706 predicted 221
7 SASI_Hs01_00236707 predicted 228
8 SASI_Hs01_00236708 predicted 199
9 SASI_Hs01_00236709 predicted 228
10 SASI_Hs01_00236710 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031810 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116859 predicted 209
2 SASI_Rn01_00116861 predicted 69
3 SASI_Rn01_00116862 predicted 183
4 SASI_Rn01_00116863 predicted 265
5 SASI_Rn01_00116864 predicted 248
6 SASI_Rn01_00116865 predicted 241
7 SASI_Rn02_00265268 predicted 217
8 SASI_Rn01_00116866 predicted 126
9 SASI_Rn01_00116867 predicted 161
10 SASI_Rn01_00116868 predicted 131
11 SASI_Rn01_00116860 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007843 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055192 predicted 688
2 SASI_Mm01_00055193 predicted 691
3 SASI_Mm02_00312599 predicted 681
4 SASI_Mm02_00312600 predicted 678
5 SASI_Mm02_00312601 predicted 644
6 SASI_Mm02_00312602 predicted 649
7 SASI_Mm01_00055201 predicted 685
8 SASI_Mm02_00312603 predicted 650
9 SASI_Mm02_00312604 predicted 650
10 SASI_Mm02_00312605 predicted 692
11 SASI_Mm01_00055194 predicted 377
12 SASI_Mm01_00055195 predicted 204
13 SASI_Mm01_00055196 predicted 463
14 SASI_Mm01_00055197 predicted 263
15 SASI_Mm01_00055198 predicted 543
16 SASI_Mm01_00055199 predicted 238
17 SASI_Mm01_00055200 predicted 246
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005218
VALIDATED
DEFB1 MISSION shRNA Bacterial Glycerol Stock
defensin, beta 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005218.3-269s1c1
Sequence:CCGGGTGGAGGGCAATGTCTCTATTCTCGAGAATAGAGACATTGCCCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005218.3-292s1c1
Sequence:CCGGGCCTGCCCGATCTTTACCAAACTCGAGTTTGGTAAAGATCGGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005218.3-206s1c1
Sequence:CCGGCCTCAGGTGGTAACTTTCTCACTCGAGTGAGAAAGTTACCACCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005218.3-323s1c1
Sequence:CCGGCCTGTTACAGAGGGAAGGCCACTCGAGTGGCCTTCCCTCTGTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005218.3-232s1c1
Sequence:CCGGCTTGGCCACAGATCTGATCATCTCGAGATGATCAGATCTGTGGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005218
VALIDATED
DEFB1 MISSION shRNA shRNA Plasmid DNA
defensin, beta 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005218.3-269s1c1
Sequence:CCGGGTGGAGGGCAATGTCTCTATTCTCGAGAATAGAGACATTGCCCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005218.3-292s1c1
Sequence:CCGGGCCTGCCCGATCTTTACCAAACTCGAGTTTGGTAAAGATCGGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005218.3-206s1c1
Sequence:CCGGCCTCAGGTGGTAACTTTCTCACTCGAGTGAGAAAGTTACCACCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005218.3-323s1c1
Sequence:CCGGCCTGTTACAGAGGGAAGGCCACTCGAGTGGCCTTCCCTCTGTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005218.3-232s1c1
Sequence:CCGGCTTGGCCACAGATCTGATCATCTCGAGATGATCAGATCTGTGGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005218
VALIDATED
DEFB1 MISSION shRNA Lentiviral Transduction Particles
defensin, beta 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005218.3-269s1c1
Sequence:CCGGGTGGAGGGCAATGTCTCTATTCTCGAGAATAGAGACATTGCCCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005218.3-292s1c1
Sequence:CCGGGCCTGCCCGATCTTTACCAAACTCGAGTTTGGTAAAGATCGGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005218.3-206s1c1
Sequence:CCGGCCTCAGGTGGTAACTTTCTCACTCGAGTGAGAAAGTTACCACCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005218.3-323s1c1
Sequence:CCGGCCTGTTACAGAGGGAAGGCCACTCGAGTGGCCTTCCCTCTGTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005218.3-232s1c1
Sequence:CCGGCTTGGCCACAGATCTGATCATCTCGAGATGATCAGATCTGTGGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007843
DEFB1 MISSION shRNA Bacterial Glycerol Stock
defensin, beta 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007843.2-604s1c1
Sequence:CCGGCCACAGTCTTAGCAGTCAGTTCTCGAGAACTGACTGCTAAGACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007843.2-150s1c1
Sequence:CCGGGATCAATACAAATGCCTTCAACTCGAGTTGAAGGCATTTGTATTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007843.2-226s1c1
Sequence:CCGGCCTGTAAACCAGATAAGCCCACTCGAGTGGGCTTATCTGGTTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007843.2-198s1c1
Sequence:CCGGTGCCCATCTAATACCAAACTACTCGAGTAGTTTGGTATTAGATGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007843.2-117s1c1
Sequence:CCGGGTTGGCATTCTCACAAGTCTTCTCGAGAAGACTTGTGAGAATGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007843
DEFB1 MISSION shRNA shRNA Plasmid DNA
defensin, beta 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007843.2-604s1c1
Sequence:CCGGCCACAGTCTTAGCAGTCAGTTCTCGAGAACTGACTGCTAAGACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007843.2-150s1c1
Sequence:CCGGGATCAATACAAATGCCTTCAACTCGAGTTGAAGGCATTTGTATTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007843.2-226s1c1
Sequence:CCGGCCTGTAAACCAGATAAGCCCACTCGAGTGGGCTTATCTGGTTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007843.2-198s1c1
Sequence:CCGGTGCCCATCTAATACCAAACTACTCGAGTAGTTTGGTATTAGATGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007843.2-117s1c1
Sequence:CCGGGTTGGCATTCTCACAAGTCTTCTCGAGAAGACTTGTGAGAATGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007843
DEFB1 MISSION shRNA Lentiviral Transduction Particles
defensin, beta 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007843.2-604s1c1
Sequence:CCGGCCACAGTCTTAGCAGTCAGTTCTCGAGAACTGACTGCTAAGACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007843.2-150s1c1
Sequence:CCGGGATCAATACAAATGCCTTCAACTCGAGTTGAAGGCATTTGTATTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007843.2-226s1c1
Sequence:CCGGCCTGTAAACCAGATAAGCCCACTCGAGTGGGCTTATCTGGTTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007843.2-198s1c1
Sequence:CCGGTGCCCATCTAATACCAAACTACTCGAGTAGTTTGGTATTAGATGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007843.2-117s1c1
Sequence:CCGGGTTGGCATTCTCACAAGTCTTCTCGAGAAGACTTGTGAGAATGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks