EMAIL THIS PAGE TO A FRIEND

DEFB4A

defensin, beta 4A

Synonyms: BD-2 DEFB-2 DEFB102 DEFB2 DEFB4 HBD-2 SAP1
UniProtKB ID: O15263, Q52LC0
Gene ID:
Human(1673) Summary: Defensins form a family of microbicidal and cytotoxic peptides made by neutrophils. Members of the defensin family are highly similar in protein sequence. This gene encodes defensin, beta 4, an antibiotic peptide which is locally regulated by inflammation. [provided by RefSeq, Jul 2008]
dog(100135059) defensin, beta 4A
cow(286836) defensin, beta 4A
15 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004942 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004942 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004942 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004942 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004942 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245332 predicted 182
2 SASI_Hs01_00245333 predicted 109
3 SASI_Hs01_00245334 predicted 105
4 SASI_Hs01_00245335 predicted 47
5 SASI_Hs01_00245336 predicted 188
6 SASI_Hs01_00245337 predicted 125
7 SASI_Hs01_00245338 predicted 301
8 SASI_Hs01_00245339 predicted 135
9 SASI_Hs01_00245340 predicted 278
10 SASI_Hs01_00245341 predicted 136
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004942
DEFB4A MISSION shRNA Bacterial Glycerol Stock
defensin, beta 4A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004942.2-58s21c1
Sequence:CCGGTTCTCGTTCCTCTTCATATTCCTCGAGGAATATGAAGAGGAACGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004942.2-41s21c1
Sequence:CCGGGGGTCTTGTATCTCCTCTTCTCTCGAGAGAAGAGGAGATACAAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004942.2-114s1c1
Sequence:CCGGCGATCCTGTTACCTGCCTTAACTCGAGTTAAGGCAGGTAACAGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004942.2-128s1c1
Sequence:CCGGGCCTTAAGAGTGGAGCCATATCTCGAGATATGGCTCCACTCTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004942.2-73s1c1
Sequence:CCGGATATTCCTGATGCCTCTTCCACTCGAGTGGAAGAGGCATCAGGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004942.2-142s1c1
Sequence:CCGGGCCATATGTCATCCAGTCTTTCTCGAGAAAGACTGGATGACATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004942.2-165s1c1
Sequence:CCGGCCCTAGAAGGTATAAACAAATCTCGAGATTTGTTTATACCTTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004942
DEFB4A MISSION shRNA shRNA Plasmid DNA
defensin, beta 4A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004942.2-58s21c1
Sequence:CCGGTTCTCGTTCCTCTTCATATTCCTCGAGGAATATGAAGAGGAACGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004942.2-41s21c1
Sequence:CCGGGGGTCTTGTATCTCCTCTTCTCTCGAGAGAAGAGGAGATACAAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004942.2-114s1c1
Sequence:CCGGCGATCCTGTTACCTGCCTTAACTCGAGTTAAGGCAGGTAACAGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004942.2-128s1c1
Sequence:CCGGGCCTTAAGAGTGGAGCCATATCTCGAGATATGGCTCCACTCTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004942.2-73s1c1
Sequence:CCGGATATTCCTGATGCCTCTTCCACTCGAGTGGAAGAGGCATCAGGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004942.2-142s1c1
Sequence:CCGGGCCATATGTCATCCAGTCTTTCTCGAGAAAGACTGGATGACATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004942.2-165s1c1
Sequence:CCGGCCCTAGAAGGTATAAACAAATCTCGAGATTTGTTTATACCTTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004942
DEFB4A MISSION shRNA Lentiviral Transduction Particles
defensin, beta 4A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004942.2-58s21c1
Sequence:CCGGTTCTCGTTCCTCTTCATATTCCTCGAGGAATATGAAGAGGAACGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004942.2-41s21c1
Sequence:CCGGGGGTCTTGTATCTCCTCTTCTCTCGAGAGAAGAGGAGATACAAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004942.2-114s1c1
Sequence:CCGGCGATCCTGTTACCTGCCTTAACTCGAGTTAAGGCAGGTAACAGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004942.2-128s1c1
Sequence:CCGGGCCTTAAGAGTGGAGCCATATCTCGAGATATGGCTCCACTCTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004942.2-73s1c1
Sequence:CCGGATATTCCTGATGCCTCTTCCACTCGAGTGGAAGAGGCATCAGGAATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004942.2-142s1c1
Sequence:CCGGGCCATATGTCATCCAGTCTTTCTCGAGAAAGACTGGATGACATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004942.2-165s1c1
Sequence:CCGGCCCTAGAAGGTATAAACAAATCTCGAGATTTGTTTATACCTTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks