EMAIL THIS PAGE TO A FRIEND

DEGS1

delta(4)-desaturase, sphingolipid 1

79 Gene Product Result for
Synonyms: DEGS DEGS-1 DES1 Des-1 FADS7 MLD
UniProtKB ID: O15121
Gene ID:
Human(8560) Summary: This gene encodes a member of the membrane fatty acid desaturase family which is responsible for inserting double bonds into specific positions in fatty acids. This protein contains three His-containing consensus motifs that are characteristic of a group of membrane fatty acid desaturases. It is predicted to be a multiple membrane-spanning protein localized to the endoplasmic reticulum. Overexpression of this gene inhibited biosynthesis of the EGF receptor, suggesting a possible role of a fatty acid desaturase in regulating biosynthetic processing of the EGF receptor. [provided by RefSeq, Mar 2010]
Mouse(13244) degenerative spermatocyte homolog 1 (Drosophila)
Rat(58970) delta(4)-desaturase, sphingolipid 1
Zebrafish(327075) degenerative spermatocyte homolog 1, lipid desaturase (Drosophila)
cow(507290) degenerative spermatocyte homolog 1, lipid desaturase (Drosophila)
domestic cat(101083993) delta(4)-desaturase, sphingolipid 1
dog(490395) delta(4)-desaturase, sphingolipid 1
chicken(421327) degenerative spermatocyte homolog 1, lipid desaturase (Drosophila)
naked mole-rat(101722992) delta(4)-desaturase, sphingolipid 1
sheep(100192315) delta(4)-desaturase, sphingolipid 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007853 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007853 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007853 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003676 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003676 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003676 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003676 Rosetta Predictions human pricing
NM_144780 Rosetta Predictions human pricing
NM_053323 Rosetta Predictions rat pricing
XM_579552 Rosetta Predictions rat pricing
NM_007853 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003676 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220627 predicted 366
2 SASI_Hs01_00220628 predicted 349
3 SASI_Hs01_00220629 predicted 209
4 SASI_Hs01_00220630 predicted 863
5 SASI_Hs01_00220631 predicted 822
6 SASI_Hs01_00220633 predicted 814
7 SASI_Hs01_00220634 predicted 658
8 SASI_Hs02_00336077 predicted 736
9 SASI_Hs01_00220635 predicted 478
10 SASI_Hs02_00336078 predicted 453
11 SASI_Hs01_00220632 predicted 740
12 SASI_Hs01_00220636 predicted 208
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144780 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080365 predicted 368
2 SASI_Hs01_00080366 predicted 357
3 SASI_Hs01_00080367 predicted 216
4 SASI_Hs01_00080368 predicted 863
5 SASI_Hs01_00080369 predicted 821
6 SASI_Hs01_00080371 predicted 812
7 SASI_Hs01_00080372 predicted 651
8 SASI_Hs02_00364727 predicted 737
9 SASI_Hs01_00080373 predicted 479
10 SASI_Hs02_00364728 predicted 447
11 SASI_Hs01_00080370 predicted 744
12 SASI_Hs01_00080374 predicted 198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053323 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049546 predicted 999
2 SASI_Rn02_00265753 predicted 302
3 SASI_Rn01_00049547 predicted 652
4 SASI_Rn02_00265754 predicted 1036
5 SASI_Rn01_00049550 predicted 949
6 SASI_Rn01_00049551 predicted 756
7 SASI_Rn02_00265755 predicted 585
8 SASI_Rn01_00049552 predicted 894
9 SASI_Rn01_00049553 predicted 744
10 SASI_Rn01_00049554 predicted 936
11 SASI_Rn01_00049548 predicted 380
12 SASI_Rn01_00049549 predicted 227
13 SASI_Rn01_00049555 predicted 872
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579552 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00169947 predicted 977
2 SASI_Rn01_00169948 predicted 646
3 SASI_Rn01_00169949 predicted 1017
4 SASI_Rn01_00169950 predicted 945
5 SASI_Rn01_00169951 predicted 750
6 SASI_Rn01_00169952 predicted 569
7 SASI_Rn01_00169953 predicted 879
8 SASI_Rn01_00169954 predicted 738
9 SASI_Rn01_00169955 predicted 925
10 SASI_Rn01_00169956 predicted 872
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007853 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138630 predicted 306
2 SASI_Mm01_00138631 predicted 667
3 SASI_Mm02_00312620 predicted 591
4 SASI_Mm02_00312621 predicted 650
5 SASI_Mm01_00138633 predicted 637
6 SASI_Mm01_00138634 predicted 916
7 SASI_Mm01_00138635 predicted 526
8 SASI_Mm01_00138636 predicted 1011
9 SASI_Mm01_00138637 predicted 485
10 SASI_Mm01_00138638 predicted 947
11 SASI_Mm01_00138632 predicted 666
12 SASI_Mm01_00138639 predicted 947
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007853
VALIDATED
DEGS1 MISSION shRNA Bacterial Glycerol Stock
delta(4)-desaturase, sphingolipid 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007853.2-1784s1c1
Sequence:CCGGCCCAATAAACTCTCTGGTTTACTCGAGTAAACCAGAGAGTTTATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007853.2-467s1c1
Sequence:CCGGCGGATAAGATTGATGTAGATACTCGAGTATCTACATCAATCTTATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007853.2-723s1c1
Sequence:CCGGGCACCCAATTTCTGGGCATTTCTCGAGAAATGCCCAGAAATTGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007853.2-123s1c1
Sequence:CCGGGCGCAAGGAGATCTTAGCAAACTCGAGTTTGCTAAGATCTCCTTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007853.2-411s1c1
Sequence:CCGGGCCATACTCGATTTCCTTTAACTCGAGTTAAAGGAAATCGAGTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007853.4-584s21c1
Sequence:GTACCGGCATCAATCCCAAACCCATTACCTCGAGGTAATGGGTTTGGGATTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379785    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007853.4-1523s21c1
Sequence:GTACCGGTCCCTCTGGATTCAATCATTTCTCGAGAAATGATTGAATCCAGAGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007853.4-466s21c1
Sequence:CCGGCGGATAAGATTGATGTAGATACTCGAGTATCTACATCAATCTTATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007853.4-410s21c1
Sequence:CCGGGCCATACTCGATTTCCTTTAACTCGAGTTAAAGGAAATCGAGTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007853.4-1000s21c1
Sequence:CCGGCTCCGAAAGGGAACGAGATTCCTCGAGGAATCTCGTTCCCTTTCGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007853.4-774s21c1
Sequence:CCGGCACGAAACCTACTCCTATTATCTCGAGATAATAGGAGTAGGTTTCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007853.4-1494s21c1
Sequence:CCGGGACTTGAGTTCATATAGTATTCTCGAGAATACTATATGAACTCAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007853.4-658s21c1
Sequence:GTACCGGATTATGTGTTTGGAGTGAAATCTCGAGATTTCACTCCAAACACATAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007853
VALIDATED
DEGS1 MISSION shRNA shRNA Plasmid DNA
delta(4)-desaturase, sphingolipid 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007853.2-1784s1c1
Sequence:CCGGCCCAATAAACTCTCTGGTTTACTCGAGTAAACCAGAGAGTTTATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007853.2-467s1c1
Sequence:CCGGCGGATAAGATTGATGTAGATACTCGAGTATCTACATCAATCTTATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007853.2-723s1c1
Sequence:CCGGGCACCCAATTTCTGGGCATTTCTCGAGAAATGCCCAGAAATTGGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007853.2-123s1c1
Sequence:CCGGGCGCAAGGAGATCTTAGCAAACTCGAGTTTGCTAAGATCTCCTTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007853.2-411s1c1
Sequence:CCGGGCCATACTCGATTTCCTTTAACTCGAGTTAAAGGAAATCGAGTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007853.4-584s21c1
Sequence:GTACCGGCATCAATCCCAAACCCATTACCTCGAGGTAATGGGTTTGGGATTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379785    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007853.4-1523s21c1
Sequence:GTACCGGTCCCTCTGGATTCAATCATTTCTCGAGAAATGATTGAATCCAGAGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007853.4-466s21c1
Sequence:CCGGCGGATAAGATTGATGTAGATACTCGAGTATCTACATCAATCTTATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007853.4-410s21c1
Sequence:CCGGGCCATACTCGATTTCCTTTAACTCGAGTTAAAGGAAATCGAGTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007853.4-1000s21c1
Sequence:CCGGCTCCGAAAGGGAACGAGATTCCTCGAGGAATCTCGTTCCCTTTCGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007853.4-774s21c1
Sequence:CCGGCACGAAACCTACTCCTATTATCTCGAGATAATAGGAGTAGGTTTCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007853.4-1494s21c1
Sequence:CCGGGACTTGAGTTCATATAGTATTCTCGAGAATACTATATGAACTCAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007853.4-658s21c1
Sequence:GTACCGGATTATGTGTTTGGAGTGAAATCTCGAGATTTCACTCCAAACACATAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007853
VALIDATED
DEGS1 MISSION shRNA Lentiviral Transduction Particles
delta(4)-desaturase, sphingolipid 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007853.2-1784s1c1
Sequence:CCGGCCCAATAAACTCTCTGGTTTACTCGAGTAAACCAGAGAGTTTATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007853.2-467s1c1
Sequence:CCGGCGGATAAGATTGATGTAGATACTCGAGTATCTACATCAATCTTATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007853.2-723s1c1
Sequence:CCGGGCACCCAATTTCTGGGCATTTCTCGAGAAATGCCCAGAAATTGGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007853.2-123s1c1
Sequence:CCGGGCGCAAGGAGATCTTAGCAAACTCGAGTTTGCTAAGATCTCCTTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007853.2-411s1c1
Sequence:CCGGGCCATACTCGATTTCCTTTAACTCGAGTTAAAGGAAATCGAGTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007853.4-584s21c1
Sequence:GTACCGGCATCAATCCCAAACCCATTACCTCGAGGTAATGGGTTTGGGATTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379785    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007853.4-1523s21c1
Sequence:GTACCGGTCCCTCTGGATTCAATCATTTCTCGAGAAATGATTGAATCCAGAGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007853.4-466s21c1
Sequence:CCGGCGGATAAGATTGATGTAGATACTCGAGTATCTACATCAATCTTATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007853.4-410s21c1
Sequence:CCGGGCCATACTCGATTTCCTTTAACTCGAGTTAAAGGAAATCGAGTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007853.4-1000s21c1
Sequence:CCGGCTCCGAAAGGGAACGAGATTCCTCGAGGAATCTCGTTCCCTTTCGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007853.4-774s21c1
Sequence:CCGGCACGAAACCTACTCCTATTATCTCGAGATAATAGGAGTAGGTTTCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007853.4-1494s21c1
Sequence:CCGGGACTTGAGTTCATATAGTATTCTCGAGAATACTATATGAACTCAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007853.4-658s21c1
Sequence:GTACCGGATTATGTGTTTGGAGTGAAATCTCGAGATTTCACTCCAAACACATAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003676
VALIDATED
DEGS1 MISSION shRNA Bacterial Glycerol Stock
delta(4)-desaturase, sphingolipid 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003676.2-802s1c1
Sequence:CCGGGCTGAGCATTACATGTTCTTACTCGAGTAAGAACATGTAATGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_003676.2-527s1c1
Sequence:CCGGGCGTCGATGTAGATATTCCTACTCGAGTAGGAATATCTACATCGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_003676.2-354s1c1
Sequence:CCGGCCACTCAATGACTCTGGCTATCTCGAGATAGCCAGAGTCATTGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003676.2-229s1c1
Sequence:CCGGGATCCCAATTTGATATGGATTCTCGAGAATCCATATCAAATTGGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003676.2-659s1c1
Sequence:CCGGCGTATCTGGAAGTTATCAATACTCGAGTATTGATAACTTCCAGATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003676.2-1009s21c1
Sequence:GTACCGGTTTGTGATGGATGATACAATACTCGAGTATTGTATCATCCATCACAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003676.2-333s21c1
Sequence:GTACCGGTGCGTTTGGCAGTTGCATTAACTCGAGTTAATGCAACTGCCAAACGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003676.2-584s21c1
Sequence:GTACCGGGAAAGTTTATATGGGTTATTCCTCGAGGAATAACCCATATAAACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003676.2-232s21c1
Sequence:CCGGCCCAATTTGATATGGATTATACTCGAGTATAATCCATATCAAATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003676.2-1196s21c1
Sequence:CCGGAGAGTAAGAGCTCGGTGATACCTCGAGGTATCACCGAGCTCTTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003676.2-870s21c1
Sequence:CCGGCTTCAATGTGGGTTATCATAACTCGAGTTATGATAACCCACATTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003676.2-826s21c1
Sequence:CCGGGGTCATGAAACTTACTCATATCTCGAGATATGAGTAAGTTTCATGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_003676.2-304s21c1
Sequence:CCGGGACTGGAAATGGGTCATATTTCTCGAGAAATATGACCCATTTCCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003676.2-659s21c1
Sequence:CCGGCGTATCTGGAAGTTATCAATACTCGAGTATTGATAACTTCCAGATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003676
VALIDATED
DEGS1 MISSION shRNA shRNA Plasmid DNA
delta(4)-desaturase, sphingolipid 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003676.2-802s1c1
Sequence:CCGGGCTGAGCATTACATGTTCTTACTCGAGTAAGAACATGTAATGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_003676.2-527s1c1
Sequence:CCGGGCGTCGATGTAGATATTCCTACTCGAGTAGGAATATCTACATCGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_003676.2-354s1c1
Sequence:CCGGCCACTCAATGACTCTGGCTATCTCGAGATAGCCAGAGTCATTGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003676.2-229s1c1
Sequence:CCGGGATCCCAATTTGATATGGATTCTCGAGAATCCATATCAAATTGGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003676.2-659s1c1
Sequence:CCGGCGTATCTGGAAGTTATCAATACTCGAGTATTGATAACTTCCAGATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003676.2-1009s21c1
Sequence:GTACCGGTTTGTGATGGATGATACAATACTCGAGTATTGTATCATCCATCACAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003676.2-333s21c1
Sequence:GTACCGGTGCGTTTGGCAGTTGCATTAACTCGAGTTAATGCAACTGCCAAACGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003676.2-584s21c1
Sequence:GTACCGGGAAAGTTTATATGGGTTATTCCTCGAGGAATAACCCATATAAACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003676.2-232s21c1
Sequence:CCGGCCCAATTTGATATGGATTATACTCGAGTATAATCCATATCAAATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003676.2-1196s21c1
Sequence:CCGGAGAGTAAGAGCTCGGTGATACCTCGAGGTATCACCGAGCTCTTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003676.2-870s21c1
Sequence:CCGGCTTCAATGTGGGTTATCATAACTCGAGTTATGATAACCCACATTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003676.2-826s21c1
Sequence:CCGGGGTCATGAAACTTACTCATATCTCGAGATATGAGTAAGTTTCATGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_003676.2-304s21c1
Sequence:CCGGGACTGGAAATGGGTCATATTTCTCGAGAAATATGACCCATTTCCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003676.2-659s21c1
Sequence:CCGGCGTATCTGGAAGTTATCAATACTCGAGTATTGATAACTTCCAGATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003676
VALIDATED
DEGS1 MISSION shRNA Lentiviral Transduction Particles
delta(4)-desaturase, sphingolipid 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003676.2-802s1c1
Sequence:CCGGGCTGAGCATTACATGTTCTTACTCGAGTAAGAACATGTAATGCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_003676.2-527s1c1
Sequence:CCGGGCGTCGATGTAGATATTCCTACTCGAGTAGGAATATCTACATCGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_003676.2-354s1c1
Sequence:CCGGCCACTCAATGACTCTGGCTATCTCGAGATAGCCAGAGTCATTGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003676.2-229s1c1
Sequence:CCGGGATCCCAATTTGATATGGATTCTCGAGAATCCATATCAAATTGGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003676.2-659s1c1
Sequence:CCGGCGTATCTGGAAGTTATCAATACTCGAGTATTGATAACTTCCAGATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003676.2-1009s21c1
Sequence:GTACCGGTTTGTGATGGATGATACAATACTCGAGTATTGTATCATCCATCACAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003676.2-333s21c1
Sequence:GTACCGGTGCGTTTGGCAGTTGCATTAACTCGAGTTAATGCAACTGCCAAACGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003676.2-584s21c1
Sequence:GTACCGGGAAAGTTTATATGGGTTATTCCTCGAGGAATAACCCATATAAACTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003676.2-232s21c1
Sequence:CCGGCCCAATTTGATATGGATTATACTCGAGTATAATCCATATCAAATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232414    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003676.2-1196s21c1
Sequence:CCGGAGAGTAAGAGCTCGGTGATACCTCGAGGTATCACCGAGCTCTTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003676.2-870s21c1
Sequence:CCGGCTTCAATGTGGGTTATCATAACTCGAGTTATGATAACCCACATTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003676.2-826s21c1
Sequence:CCGGGGTCATGAAACTTACTCATATCTCGAGATATGAGTAAGTTTCATGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_003676.2-304s21c1
Sequence:CCGGGACTGGAAATGGGTCATATTTCTCGAGAAATATGACCCATTTCCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003676.2-659s21c1
Sequence:CCGGCGTATCTGGAAGTTATCAATACTCGAGTATTGATAACTTCCAGATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)