EMAIL THIS PAGE TO A FRIEND

DEGS2

delta(4)-desaturase, sphingolipid 2

46 Gene Product Result for
Synonyms: C14orf66 DES2 FADS8
UniProtKB ID: Q6QHC5, Q6P492
Gene ID:
Human(123099) Summary: This gene encodes a bifunctional enzyme that is involved in the biosynthesis of phytosphingolipids in human skin and in other phytosphingolipid-containing tissues. This enzyme can act as a sphingolipid delta(4)-desaturase, and also as a sphingolipid C4-hydroxylase. [provided by RefSeq, Oct 2008]
Mouse(70059) degenerative spermatocyte homolog 2 (Drosophila), lipid desaturase
Rat(314438) delta(4)-desaturase, sphingolipid 2
sheep(101118389) delta(4)-desaturase, sphingolipid 2
naked mole-rat(101706415) delta(4)-desaturase, sphingolipid 2
domestic guinea pig(100725617) delta(4)-desaturase, sphingolipid 2
Zebrafish(402799) degenerative spermatocyte homolog 2, lipid desaturase (Drosophila)
cow(540994) degenerative spermatocyte homolog 2, lipid desaturase (Drosophila)
domestic cat(101080546) delta(4)-desaturase, sphingolipid 2
dog(490854) delta(4)-desaturase, sphingolipid 2
chicken(423454) degenerative spermatocyte homolog 2, lipid desaturase (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_206918 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_206918 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_206918 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027299 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027299 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027299 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_206918 Rosetta Predictions human pricing
NM_001017457 Rosetta Predictions rat pricing
NM_027299 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373606 predicted 907
2 SASI_Hs01_00117319 predicted 716
3 SASI_Hs02_00373607 predicted 714
4 SASI_Hs01_00117320 predicted 967
5 SASI_Hs01_00117321 predicted 771
6 SASI_Hs01_00117322 predicted 288
7 SASI_Hs01_00117324 predicted 465
8 SASI_Hs02_00373608 predicted 799
9 SASI_Hs01_00117325 predicted 856
10 SASI_Hs01_00117326 predicted 1066
11 SASI_Hs01_00117318 predicted 767
12 SASI_Hs01_00117323 predicted 260
13 SASI_Hs01_00117327 predicted 755
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017457 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037136 predicted 799
2 SASI_Rn01_00037137 predicted 321
3 SASI_Rn01_00037138 predicted 889
4 SASI_Rn01_00037140 predicted 606
5 SASI_Rn02_00202253 predicted 832
6 SASI_Rn01_00037141 predicted 776
7 SASI_Rn01_00037142 predicted 340
8 SASI_Rn01_00037143 predicted 421
9 SASI_Rn01_00037144 predicted 641
10 SASI_Rn01_00037145 predicted 984
11 SASI_Rn01_00037139 predicted 802
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027299 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166251 predicted 626
2 SASI_Mm01_00166252 predicted 794
3 SASI_Mm01_00166253 predicted 870
4 SASI_Mm01_00166254 predicted 266
5 SASI_Mm01_00166255 predicted 304
6 SASI_Mm01_00166256 predicted 873
7 SASI_Mm01_00166257 predicted 921
8 SASI_Mm01_00166258 predicted 1011
9 SASI_Mm01_00166259 predicted 755
10 SASI_Mm01_00166260 predicted 354
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_206918
DEGS2 MISSION shRNA Bacterial Glycerol Stock
delta(4)-desaturase, sphingolipid 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206918.2-297s21c1
Sequence:CCGGTGTTCTGGGCCTACGCCTTTGCTCGAGCAAAGGCGTAGGCCCAGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206918.2-350s21c1
Sequence:CCGGATCCACGACATCTCGCACAACCTCGAGGTTGTGCGAGATGTCGTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206918.2-460s21c1
Sequence:CCGGCAAGAAGTACCACGTGGACCACTCGAGTGGTCCACGTGGTACTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206918.1-728s1c1
Sequence:CCGGCGAGCACTACATGTTCCTCAACTCGAGTTGAGGAACATGTAGTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206918.1-531s1c1
Sequence:CCGGCAGCCCTTCTTCTACTCACTACTCGAGTAGTGAGTAGAAGAAGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206918.1-780s1c1
Sequence:CCGGCTCAACTGGATCACCTTCAATCTCGAGATTGAAGGTGATCCAGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206918.1-753s1c1
Sequence:CCGGCACGAGACCTACTCCTACTATCTCGAGATAGTAGGAGTAGGTCTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206918.1-101s1c1
Sequence:CCGGGCGCAAGGAGATACTGGCCAACTCGAGTTGGCCAGTATCTCCTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_206918
DEGS2 MISSION shRNA shRNA Plasmid DNA
delta(4)-desaturase, sphingolipid 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206918.2-297s21c1
Sequence:CCGGTGTTCTGGGCCTACGCCTTTGCTCGAGCAAAGGCGTAGGCCCAGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206918.2-350s21c1
Sequence:CCGGATCCACGACATCTCGCACAACCTCGAGGTTGTGCGAGATGTCGTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206918.2-460s21c1
Sequence:CCGGCAAGAAGTACCACGTGGACCACTCGAGTGGTCCACGTGGTACTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206918.1-728s1c1
Sequence:CCGGCGAGCACTACATGTTCCTCAACTCGAGTTGAGGAACATGTAGTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206918.1-531s1c1
Sequence:CCGGCAGCCCTTCTTCTACTCACTACTCGAGTAGTGAGTAGAAGAAGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206918.1-780s1c1
Sequence:CCGGCTCAACTGGATCACCTTCAATCTCGAGATTGAAGGTGATCCAGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206918.1-753s1c1
Sequence:CCGGCACGAGACCTACTCCTACTATCTCGAGATAGTAGGAGTAGGTCTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206918.1-101s1c1
Sequence:CCGGGCGCAAGGAGATACTGGCCAACTCGAGTTGGCCAGTATCTCCTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_206918
DEGS2 MISSION shRNA Lentiviral Transduction Particles
delta(4)-desaturase, sphingolipid 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206918.2-297s21c1
Sequence:CCGGTGTTCTGGGCCTACGCCTTTGCTCGAGCAAAGGCGTAGGCCCAGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206918.2-350s21c1
Sequence:CCGGATCCACGACATCTCGCACAACCTCGAGGTTGTGCGAGATGTCGTGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_206918.2-460s21c1
Sequence:CCGGCAAGAAGTACCACGTGGACCACTCGAGTGGTCCACGTGGTACTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206918.1-728s1c1
Sequence:CCGGCGAGCACTACATGTTCCTCAACTCGAGTTGAGGAACATGTAGTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206918.1-531s1c1
Sequence:CCGGCAGCCCTTCTTCTACTCACTACTCGAGTAGTGAGTAGAAGAAGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206918.1-780s1c1
Sequence:CCGGCTCAACTGGATCACCTTCAATCTCGAGATTGAAGGTGATCCAGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206918.1-753s1c1
Sequence:CCGGCACGAGACCTACTCCTACTATCTCGAGATAGTAGGAGTAGGTCTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_206918.1-101s1c1
Sequence:CCGGGCGCAAGGAGATACTGGCCAACTCGAGTTGGCCAGTATCTCCTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027299
DEGS2 MISSION shRNA Bacterial Glycerol Stock
delta(4)-desaturase, sphingolipid 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027299.2-635s1c1
Sequence:CCGGGCATTTGATGTCACCATCTTTCTCGAGAAAGATGGTGACATCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027299.2-879s1c1
Sequence:CCGGTGCGGAAGATTGCACCTGAATCTCGAGATTCAGGTGCAATCTTCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027299.2-1123s1c1
Sequence:CCGGCCCAGCAAGTAGATAGATACACTCGAGTGTATCTATCTACTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027299.2-407s1c1
Sequence:CCGGCCTTACGCTACATCCTTCAAACTCGAGTTTGAAGGATGTAGCGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027299.2-880s1c1
Sequence:CCGGGCGGAAGATTGCACCTGAATACTCGAGTATTCAGGTGCAATCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027299
DEGS2 MISSION shRNA shRNA Plasmid DNA
delta(4)-desaturase, sphingolipid 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027299.2-635s1c1
Sequence:CCGGGCATTTGATGTCACCATCTTTCTCGAGAAAGATGGTGACATCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027299.2-879s1c1
Sequence:CCGGTGCGGAAGATTGCACCTGAATCTCGAGATTCAGGTGCAATCTTCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027299.2-1123s1c1
Sequence:CCGGCCCAGCAAGTAGATAGATACACTCGAGTGTATCTATCTACTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027299.2-407s1c1
Sequence:CCGGCCTTACGCTACATCCTTCAAACTCGAGTTTGAAGGATGTAGCGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027299.2-880s1c1
Sequence:CCGGGCGGAAGATTGCACCTGAATACTCGAGTATTCAGGTGCAATCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027299
DEGS2 MISSION shRNA Lentiviral Transduction Particles
delta(4)-desaturase, sphingolipid 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027299.2-635s1c1
Sequence:CCGGGCATTTGATGTCACCATCTTTCTCGAGAAAGATGGTGACATCAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027299.2-879s1c1
Sequence:CCGGTGCGGAAGATTGCACCTGAATCTCGAGATTCAGGTGCAATCTTCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027299.2-1123s1c1
Sequence:CCGGCCCAGCAAGTAGATAGATACACTCGAGTGTATCTATCTACTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027299.2-407s1c1
Sequence:CCGGCCTTACGCTACATCCTTCAAACTCGAGTTTGAAGGATGTAGCGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027299.2-880s1c1
Sequence:CCGGGCGGAAGATTGCACCTGAATACTCGAGTATTCAGGTGCAATCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks