EMAIL THIS PAGE TO A FRIEND

DEK

DEK oncogene

122 Gene Product Result for
Synonyms: D6S231E
UniProtKB ID: P35659, B2R6K6, B4DN37, Q5TGV4, Q5TGV5
Gene ID:
Human(7913) Summary: This gene encodes a protein with one SAP domain. This protein binds to cruciform and superhelical DNA and induces positive supercoils into closed circular DNA, and is also involved in splice site selection during mRNA processing. Chromosomal aberrations involving this region, increased expression of this gene, and the presence of antibodies against this protein are all associated with various diseases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
Mouse(110052) DEK oncogene (DNA binding)
Rat(306817) DEK oncogene
Zebrafish(692304) DEK oncogene
fruit fly(47906) CG5935 gene product from transcript CG5935-RE
cow(540945) DEK oncogene
dog(610538) DEK oncogene
chicken(420828) DEK oncogene
sheep(101122732) DEK oncogene
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025900 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025900 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025900 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003472 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003472 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003472 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003472 Rosetta Predictions human pricing
NM_001004255 Rosetta Predictions rat pricing
NM_025900 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003472 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011598 predicted 1333
2 SASI_Hs01_00011599 predicted 690
3 SASI_Hs01_00011600 predicted 698
4 SASI_Hs01_00011601 predicted 575
5 SASI_Hs02_00335731 predicted 1354
6 SASI_Hs01_00011602 predicted 1532
7 SASI_Hs01_00011603 predicted 668
8 SASI_Hs01_00011604 predicted 1419
9 SASI_Hs01_00011605 predicted 1582
10 SASI_Hs01_00011606 predicted 1350
11 SASI_Hs01_00011607 predicted 1439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004255 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086208 predicted 1505
2 SASI_Rn01_00086209 predicted 1264
3 SASI_Rn02_00198274 predicted 1292
4 SASI_Rn01_00086210 predicted 1516
5 SASI_Rn01_00086211 predicted 1249
6 SASI_Rn01_00086212 predicted 587
7 SASI_Rn01_00086213 predicted 1223
8 SASI_Rn01_00086214 predicted 619
9 SASI_Rn01_00086215 predicted 1136
10 SASI_Rn01_00086217 predicted 625
11 SASI_Rn01_00086216 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025900 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158765 predicted 1464
2 SASI_Mm01_00158766 predicted 1259
3 SASI_Mm01_00158767 predicted 538
4 SASI_Mm01_00158768 predicted 528
5 SASI_Mm01_00158769 predicted 565
6 SASI_Mm01_00158770 predicted 1349
7 SASI_Mm01_00158771 predicted 1463
8 SASI_Mm01_00158772 predicted 1295
9 SASI_Mm01_00158773 predicted 1423
10 SASI_Mm01_00158774 predicted 1240
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025900
VALIDATED
DEK MISSION shRNA Bacterial Glycerol Stock
DEK oncogene
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025900.1-1532s1c1
Sequence:CCGGGCAAAGACTATTGCAGTATTTCTCGAGAAATACTGCAATAGTCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025900.1-714s1c1
Sequence:CCGGGCAAACTAAATGCCCTGAAATCTCGAGATTTCAGGGCATTTAGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025900.1-715s1c1
Sequence:CCGGCAAACTAAATGCCCTGAAATTCTCGAGAATTTCAGGGCATTTAGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025900.1-1048s1c1
Sequence:CCGGGTGAAGAAATTACTGGCTGATCTCGAGATCAGCCAGTAATTTCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025900.1-579s1c1
Sequence:CCGGCGAACTCGTGAAGAGGATCTTCTCGAGAAGATCCTCTTCACGAGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025900.1-714s21c1
Sequence:CCGGGCAAACTAAATGCCCTGAAATCTCGAGATTTCAGGGCATTTAGTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025900.1-1532s21c1
Sequence:CCGGGCAAAGACTATTGCAGTATTTCTCGAGAAATACTGCAATAGTCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025900.1-579s21c1
Sequence:CCGGCGAACTCGTGAAGAGGATCTTCTCGAGAAGATCCTCTTCACGAGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025900.1-1048s21c1
Sequence:CCGGGTGAAGAAATTACTGGCTGATCTCGAGATCAGCCAGTAATTTCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025900
VALIDATED
DEK MISSION shRNA shRNA Plasmid DNA
DEK oncogene
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025900.1-1532s1c1
Sequence:CCGGGCAAAGACTATTGCAGTATTTCTCGAGAAATACTGCAATAGTCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025900.1-714s1c1
Sequence:CCGGGCAAACTAAATGCCCTGAAATCTCGAGATTTCAGGGCATTTAGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025900.1-715s1c1
Sequence:CCGGCAAACTAAATGCCCTGAAATTCTCGAGAATTTCAGGGCATTTAGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025900.1-1048s1c1
Sequence:CCGGGTGAAGAAATTACTGGCTGATCTCGAGATCAGCCAGTAATTTCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025900.1-579s1c1
Sequence:CCGGCGAACTCGTGAAGAGGATCTTCTCGAGAAGATCCTCTTCACGAGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025900.1-714s21c1
Sequence:CCGGGCAAACTAAATGCCCTGAAATCTCGAGATTTCAGGGCATTTAGTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025900.1-1532s21c1
Sequence:CCGGGCAAAGACTATTGCAGTATTTCTCGAGAAATACTGCAATAGTCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025900.1-579s21c1
Sequence:CCGGCGAACTCGTGAAGAGGATCTTCTCGAGAAGATCCTCTTCACGAGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025900.1-1048s21c1
Sequence:CCGGGTGAAGAAATTACTGGCTGATCTCGAGATCAGCCAGTAATTTCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025900
VALIDATED
DEK MISSION shRNA Lentiviral Transduction Particles
DEK oncogene
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025900.1-1532s1c1
Sequence:CCGGGCAAAGACTATTGCAGTATTTCTCGAGAAATACTGCAATAGTCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025900.1-714s1c1
Sequence:CCGGGCAAACTAAATGCCCTGAAATCTCGAGATTTCAGGGCATTTAGTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025900.1-715s1c1
Sequence:CCGGCAAACTAAATGCCCTGAAATTCTCGAGAATTTCAGGGCATTTAGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025900.1-1048s1c1
Sequence:CCGGGTGAAGAAATTACTGGCTGATCTCGAGATCAGCCAGTAATTTCTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025900.1-579s1c1
Sequence:CCGGCGAACTCGTGAAGAGGATCTTCTCGAGAAGATCCTCTTCACGAGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025900.1-714s21c1
Sequence:CCGGGCAAACTAAATGCCCTGAAATCTCGAGATTTCAGGGCATTTAGTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025900.1-1532s21c1
Sequence:CCGGGCAAAGACTATTGCAGTATTTCTCGAGAAATACTGCAATAGTCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025900.1-579s21c1
Sequence:CCGGCGAACTCGTGAAGAGGATCTTCTCGAGAAGATCCTCTTCACGAGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025900.1-1048s21c1
Sequence:CCGGGTGAAGAAATTACTGGCTGATCTCGAGATCAGCCAGTAATTTCTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003472
VALIDATED
DEK MISSION shRNA Bacterial Glycerol Stock
DEK oncogene
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013103    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_003472.2-2065s1c1
Sequence:CCGGGCCTCGAAAGTGTCATCAATTCTCGAGAATTGATGACACTTTCGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_003472.2-832s1c1
Sequence:CCGGCCTGAAATTCTGTCAGATGAACTCGAGTTCATCTGACAGAATTTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_003472.2-1165s1c1
Sequence:CCGGGCCAGTGCTAACTTGGAAGAACTCGAGTTCTTCCAAGTTAGCACTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003472.2-523s1c1
Sequence:CCGGGTGTCCTCATTAAAGAAGAATCTCGAGATTCTTCTTTAATGAGGACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003472.2-1003s1c1
Sequence:CCGGGCCAATGTTAAGAAAGCAGATCTCGAGATCTGCTTTCTTAACATTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003472.3-460s21c1
Sequence:CCGGTGAAATTGAGAGGATACATTTCTCGAGAAATGTATCCTCTCAATTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_003472.3-544s21c1
Sequence:CCGGAGGCACTGTGTCCTCATTAAACTCGAGTTTAATGAGGACACAGTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003472.3-2334s21c1
Sequence:CCGGTGACTAAAGTACCAGATTATACTCGAGTATAATCTGGTACTTTAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_003472.3-247s21c1
Sequence:CCGGGTCCGAGAAAGAACCCGAAATCTCGAGATTTCGGGTTCTTTCTCGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_003472.3-1150s21c1
Sequence:CCGGCCCTACAGATGAAGAGTTAAACTCGAGTTTAACTCTTCATCTGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003472
VALIDATED
DEK MISSION shRNA shRNA Plasmid DNA
DEK oncogene
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013103    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_003472.2-2065s1c1
Sequence:CCGGGCCTCGAAAGTGTCATCAATTCTCGAGAATTGATGACACTTTCGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_003472.2-832s1c1
Sequence:CCGGCCTGAAATTCTGTCAGATGAACTCGAGTTCATCTGACAGAATTTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_003472.2-1165s1c1
Sequence:CCGGGCCAGTGCTAACTTGGAAGAACTCGAGTTCTTCCAAGTTAGCACTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003472.2-523s1c1
Sequence:CCGGGTGTCCTCATTAAAGAAGAATCTCGAGATTCTTCTTTAATGAGGACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003472.2-1003s1c1
Sequence:CCGGGCCAATGTTAAGAAAGCAGATCTCGAGATCTGCTTTCTTAACATTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003472.3-460s21c1
Sequence:CCGGTGAAATTGAGAGGATACATTTCTCGAGAAATGTATCCTCTCAATTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_003472.3-544s21c1
Sequence:CCGGAGGCACTGTGTCCTCATTAAACTCGAGTTTAATGAGGACACAGTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003472.3-2334s21c1
Sequence:CCGGTGACTAAAGTACCAGATTATACTCGAGTATAATCTGGTACTTTAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_003472.3-247s21c1
Sequence:CCGGGTCCGAGAAAGAACCCGAAATCTCGAGATTTCGGGTTCTTTCTCGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_003472.3-1150s21c1
Sequence:CCGGCCCTACAGATGAAGAGTTAAACTCGAGTTTAACTCTTCATCTGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003472
VALIDATED
DEK MISSION shRNA Lentiviral Transduction Particles
DEK oncogene
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013103    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_003472.2-2065s1c1
Sequence:CCGGGCCTCGAAAGTGTCATCAATTCTCGAGAATTGATGACACTTTCGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_003472.2-832s1c1
Sequence:CCGGCCTGAAATTCTGTCAGATGAACTCGAGTTCATCTGACAGAATTTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_003472.2-1165s1c1
Sequence:CCGGGCCAGTGCTAACTTGGAAGAACTCGAGTTCTTCCAAGTTAGCACTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003472.2-523s1c1
Sequence:CCGGGTGTCCTCATTAAAGAAGAATCTCGAGATTCTTCTTTAATGAGGACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003472.2-1003s1c1
Sequence:CCGGGCCAATGTTAAGAAAGCAGATCTCGAGATCTGCTTTCTTAACATTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003472.3-460s21c1
Sequence:CCGGTGAAATTGAGAGGATACATTTCTCGAGAAATGTATCCTCTCAATTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_003472.3-544s21c1
Sequence:CCGGAGGCACTGTGTCCTCATTAAACTCGAGTTTAATGAGGACACAGTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003472.3-2334s21c1
Sequence:CCGGTGACTAAAGTACCAGATTATACTCGAGTATAATCTGGTACTTTAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_003472.3-247s21c1
Sequence:CCGGGTCCGAGAAAGAACCCGAAATCTCGAGATTTCGGGTTCTTTCTCGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_003472.3-1150s21c1
Sequence:CCGGCCCTACAGATGAAGAGTTAAACTCGAGTTTAACTCTTCATCTGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)