EMAIL THIS PAGE TO A FRIEND

DENND1A

DENN/MADD domain containing 1A

108 Gene Product Result for
Synonyms: FAM31A KIAA1608 RP11-230L22.3
Gene ID:
Human(57706) Summary: Clathrin (see MIM 118955)-mediated endocytosis is a major mechanism for internalization of proteins and lipids. Members of the connecdenn family, such as DENND1A, function as guanine nucleotide exchange factors (GEFs) for the early endosomal small GTPase RAB35 (MIM 604199) and bind to clathrin and clathrin adaptor protein-2 (AP2; see MIM 601024). Thus, connecdenns link RAB35 activation with the clathrin machinery (Marat and McPherson, 2010 [PubMed 20154091]
Mouse(227801) DENN/MADD domain containing 1A
Rat(311913) DENN/MADD domain containing 1A
Zebrafish(556150) DENN/MADD domain containing 1A
chicken(417102) DENN/MADD domain containing 1A
dog(609706) DENN/MADD domain containing 1A
domestic cat(101088373) DENN/MADD domain containing 1A
cow(514134) DENN/MADD domain containing 1A
Horse(100067362) DENN/MADD domain containing 1A
sheep(101113668) DENN/MADD domain containing 1A
Domestic Rabbit(100340700) DENN/MADD domain containing 1A
naked mole-rat(101722066) DENN/MADD domain containing 1A
domestic guinea pig(100735930) DENN/MADD domain containing 1A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024820 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024820 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024820 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146122 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146122 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146122 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020946 Rosetta Predictions human pricing
NM_024820 Rosetta Predictions human pricing
XM_001054659 Rosetta Predictions rat pricing
XM_001054730 Rosetta Predictions rat pricing
XM_231184 Rosetta Predictions rat pricing
NM_146122 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020946 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354350 predicted 1180
2 SASI_Hs01_00135450 predicted 1518
3 SASI_Hs01_00135451 predicted 487
4 SASI_Hs01_00135455 predicted 455
5 SASI_Hs01_00135456 predicted 420
6 SASI_Hs02_00354351 predicted 622
7 SASI_Hs02_00354352 predicted 1495
8 SASI_Hs02_00354353 predicted 1326
9 SASI_Hs02_00354354 predicted 973
10 SASI_Hs02_00354355 predicted 668
11 SASI_Hs01_00135449 predicted 457
12 SASI_Hs01_00135452 predicted 618
13 SASI_Hs01_00135453 predicted 1462
14 SASI_Hs01_00135454 predicted 1439
15 SASI_Hs01_00135457 predicted 486
16 SASI_Hs01_00135458 predicted 1405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024820 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234658 predicted 1182
2 SASI_Hs01_00234659 predicted 1515
3 SASI_Hs01_00234660 predicted 494
4 SASI_Hs01_00234662 predicted 460
5 SASI_Hs01_00234663 predicted 422
6 SASI_Hs01_00234664 predicted 622
7 SASI_Hs01_00234665 predicted 1493
8 SASI_Hs01_00234666 predicted 1326
9 SASI_Hs01_00234667 predicted 980
10 SASI_Hs02_00357384 predicted 674
11 SASI_Hs01_00234661 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054659 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276677 predicted 556
2 SASI_Rn02_00276678 predicted 1344
3 SASI_Rn02_00276679 predicted 1449
4 SASI_Rn02_00276680 predicted 401
5 SASI_Rn02_00276681 predicted 1231
6 SASI_Rn02_00276682 predicted 1534
7 SASI_Rn02_00276683 predicted 776
8 SASI_Rn02_00276684 predicted 1059
9 SASI_Rn02_00276685 predicted 320
10 SASI_Rn02_00276686 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054730 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276969 predicted 591
2 SASI_Rn02_00276970 predicted 1383
3 SASI_Rn02_00276971 predicted 1480
4 SASI_Rn02_00276972 predicted 432
5 SASI_Rn02_00276973 predicted 1267
6 SASI_Rn02_00276974 predicted 1575
7 SASI_Rn02_00276975 predicted 819
8 SASI_Rn02_00276976 predicted 1095
9 SASI_Rn02_00276977 predicted 316
10 SASI_Rn02_00276978 predicted 644
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_231184 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386714 predicted 3657
2 SASI_Rn02_00386715 predicted 3557
3 SASI_Rn02_00386716 predicted 2382
4 SASI_Rn02_00386717 predicted 2779
5 SASI_Rn02_00386718 predicted 2358
6 SASI_Rn02_00386719 predicted 3618
7 SASI_Rn02_00386720 predicted 3548
8 SASI_Rn02_00386721 predicted 3736
9 SASI_Rn02_00386722 predicted 3704
10 SASI_Rn02_00386723 predicted 3698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146122 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095421 predicted 600
2 SASI_Mm02_00341786 predicted 714
3 SASI_Mm02_00341787 predicted 1208
4 SASI_Mm01_00095422 predicted 2093
5 SASI_Mm01_00095423 predicted 2723
6 SASI_Mm01_00095424 predicted 1391
7 SASI_Mm01_00095426 predicted 536
8 SASI_Mm01_00095427 predicted 874
9 SASI_Mm01_00095428 predicted 1259
10 SASI_Mm01_00095429 predicted 442
11 SASI_Mm01_00095425 predicted 1494
12 SASI_Mm01_00095430 predicted 353
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024820
VALIDATED
DENND1A MISSION shRNA Bacterial Glycerol Stock
DENN/MADD domain containing 1A
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_024820.2-482s21c1
Sequence:CCGGATTCGGGTTCTGCCGCTTATCCTCGAGGATAAGCGGCAGAACCCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024820.2-1976s21c1
Sequence:CCGGCGGTGTCTGATAATCCCATTTCTCGAGAAATGGGATTATCAGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_024820.2-362s21c1
Sequence:CCGGCCAGGAAGTTCTACAGACTTTCTCGAGAAAGTCTGTAGAACTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_024820.2-785s21c1
Sequence:CCGGGTTGCATCTGTACGCCAGTATCTCGAGATACTGGCGTACAGATGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_024820.2-966s21c1
Sequence:CCGGTACCTCATAGGAATCCATTTACTCGAGTAAATGGATTCCTATGAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024820.1-1453s1c1
Sequence:CCGGGAAGTGGAGCAATTCTGAATACTCGAGTATTCAGAATTGCTCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_024820.1-1505s1c1
Sequence:CCGGGACTGTCTACAAGTTCGCAAACTCGAGTTTGCGAACTTGTAGACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_024820.1-350s1c1
Sequence:CCGGCCAGGAAGTTCTACAGACTTTCTCGAGAAAGTCTGTAGAACTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_024820.1-557s1c1
Sequence:CCGGGCTTAACATCCTGGCAGATTACTCGAGTAATCTGCCAGGATGTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_024820.1-773s1c1
Sequence:CCGGGTTGCATCTGTACGCCAGTATCTCGAGATACTGGCGTACAGATGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024820.1-460s1c1
Sequence:CCGGGCAAACAGAGATTCGGGTTCTCTCGAGAGAACCCGAATCTCTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024820.1-1019s1c1
Sequence:CCGGGATCCTGAATGTGGACACCAACTCGAGTTGGTGTCCACATTCAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024820.1-1338s1c1
Sequence:CCGGGATCTTCTCAATTCCGGCGAACTCGAGTTCGCCGGAATTGAGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024820.1-339s1c1
Sequence:CCGGGACTACAGTGACCAGGAAGTTCTCGAGAACTTCCTGGTCACTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024820.1-801s1c1
Sequence:CCGGGAACGCCGGATACTCATCATTCTCGAGAATGATGAGTATCCGGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024820
VALIDATED
DENND1A MISSION shRNA shRNA Plasmid DNA
DENN/MADD domain containing 1A
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_024820.2-482s21c1
Sequence:CCGGATTCGGGTTCTGCCGCTTATCCTCGAGGATAAGCGGCAGAACCCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024820.2-1976s21c1
Sequence:CCGGCGGTGTCTGATAATCCCATTTCTCGAGAAATGGGATTATCAGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_024820.2-362s21c1
Sequence:CCGGCCAGGAAGTTCTACAGACTTTCTCGAGAAAGTCTGTAGAACTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_024820.2-785s21c1
Sequence:CCGGGTTGCATCTGTACGCCAGTATCTCGAGATACTGGCGTACAGATGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_024820.2-966s21c1
Sequence:CCGGTACCTCATAGGAATCCATTTACTCGAGTAAATGGATTCCTATGAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024820.1-1453s1c1
Sequence:CCGGGAAGTGGAGCAATTCTGAATACTCGAGTATTCAGAATTGCTCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_024820.1-1505s1c1
Sequence:CCGGGACTGTCTACAAGTTCGCAAACTCGAGTTTGCGAACTTGTAGACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_024820.1-350s1c1
Sequence:CCGGCCAGGAAGTTCTACAGACTTTCTCGAGAAAGTCTGTAGAACTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_024820.1-557s1c1
Sequence:CCGGGCTTAACATCCTGGCAGATTACTCGAGTAATCTGCCAGGATGTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_024820.1-773s1c1
Sequence:CCGGGTTGCATCTGTACGCCAGTATCTCGAGATACTGGCGTACAGATGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024820.1-460s1c1
Sequence:CCGGGCAAACAGAGATTCGGGTTCTCTCGAGAGAACCCGAATCTCTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024820.1-1019s1c1
Sequence:CCGGGATCCTGAATGTGGACACCAACTCGAGTTGGTGTCCACATTCAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024820.1-1338s1c1
Sequence:CCGGGATCTTCTCAATTCCGGCGAACTCGAGTTCGCCGGAATTGAGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024820.1-339s1c1
Sequence:CCGGGACTACAGTGACCAGGAAGTTCTCGAGAACTTCCTGGTCACTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024820.1-801s1c1
Sequence:CCGGGAACGCCGGATACTCATCATTCTCGAGAATGATGAGTATCCGGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024820
VALIDATED
DENND1A MISSION shRNA Lentiviral Transduction Particles
DENN/MADD domain containing 1A
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_024820.2-482s21c1
Sequence:CCGGATTCGGGTTCTGCCGCTTATCCTCGAGGATAAGCGGCAGAACCCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024820.2-1976s21c1
Sequence:CCGGCGGTGTCTGATAATCCCATTTCTCGAGAAATGGGATTATCAGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_024820.2-362s21c1
Sequence:CCGGCCAGGAAGTTCTACAGACTTTCTCGAGAAAGTCTGTAGAACTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_024820.2-785s21c1
Sequence:CCGGGTTGCATCTGTACGCCAGTATCTCGAGATACTGGCGTACAGATGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_024820.2-966s21c1
Sequence:CCGGTACCTCATAGGAATCCATTTACTCGAGTAAATGGATTCCTATGAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024820.1-1453s1c1
Sequence:CCGGGAAGTGGAGCAATTCTGAATACTCGAGTATTCAGAATTGCTCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_024820.1-1505s1c1
Sequence:CCGGGACTGTCTACAAGTTCGCAAACTCGAGTTTGCGAACTTGTAGACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_024820.1-350s1c1
Sequence:CCGGCCAGGAAGTTCTACAGACTTTCTCGAGAAAGTCTGTAGAACTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_024820.1-557s1c1
Sequence:CCGGGCTTAACATCCTGGCAGATTACTCGAGTAATCTGCCAGGATGTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_024820.1-773s1c1
Sequence:CCGGGTTGCATCTGTACGCCAGTATCTCGAGATACTGGCGTACAGATGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024820.1-460s1c1
Sequence:CCGGGCAAACAGAGATTCGGGTTCTCTCGAGAGAACCCGAATCTCTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024820.1-1019s1c1
Sequence:CCGGGATCCTGAATGTGGACACCAACTCGAGTTGGTGTCCACATTCAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024820.1-1338s1c1
Sequence:CCGGGATCTTCTCAATTCCGGCGAACTCGAGTTCGCCGGAATTGAGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024820.1-339s1c1
Sequence:CCGGGACTACAGTGACCAGGAAGTTCTCGAGAACTTCCTGGTCACTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024820.1-801s1c1
Sequence:CCGGGAACGCCGGATACTCATCATTCTCGAGAATGATGAGTATCCGGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146122
DENND1A MISSION shRNA Bacterial Glycerol Stock
DENN/MADD domain containing 1A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146122.2-247s21c1
Sequence:CCGGAGACTACATTTGAAGTGTATGCTCGAGCATACACTTCAAATGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146122.2-951s21c1
Sequence:CCGGTACCTCATAGGAATCCATTTACTCGAGTAAATGGATTCCTATGAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146122.2-3807s21c1
Sequence:CCGGACACCAGCAACTCTAACTTATCTCGAGATAAGTTAGAGTTGCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146122.2-467s21c1
Sequence:CCGGATTCGGGTTCTGCCGCTTATCCTCGAGGATAAGCGGCAGAACCCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146122.2-2104s21c1
Sequence:CCGGTGAAGCTTGCTCATCCATATACTCGAGTATATGGATGAGCAAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146122.2-709s1c1
Sequence:CCGGCCAGCATACCTGAGAATAGAACTCGAGTTCTATTCTCAGGTATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146122.2-1364s1c1
Sequence:CCGGCGATGTCTTTGAGGAGGAAATCTCGAGATTTCCTCCTCAAAGACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146122.2-662s1c1
Sequence:CCGGCCTCAGTGTGTATTCTTACTTCTCGAGAAGTAAGAATACACACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146122
DENND1A MISSION shRNA shRNA Plasmid DNA
DENN/MADD domain containing 1A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146122.2-247s21c1
Sequence:CCGGAGACTACATTTGAAGTGTATGCTCGAGCATACACTTCAAATGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146122.2-951s21c1
Sequence:CCGGTACCTCATAGGAATCCATTTACTCGAGTAAATGGATTCCTATGAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146122.2-3807s21c1
Sequence:CCGGACACCAGCAACTCTAACTTATCTCGAGATAAGTTAGAGTTGCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146122.2-467s21c1
Sequence:CCGGATTCGGGTTCTGCCGCTTATCCTCGAGGATAAGCGGCAGAACCCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146122.2-2104s21c1
Sequence:CCGGTGAAGCTTGCTCATCCATATACTCGAGTATATGGATGAGCAAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146122.2-709s1c1
Sequence:CCGGCCAGCATACCTGAGAATAGAACTCGAGTTCTATTCTCAGGTATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146122.2-1364s1c1
Sequence:CCGGCGATGTCTTTGAGGAGGAAATCTCGAGATTTCCTCCTCAAAGACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146122.2-662s1c1
Sequence:CCGGCCTCAGTGTGTATTCTTACTTCTCGAGAAGTAAGAATACACACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146122
DENND1A MISSION shRNA Lentiviral Transduction Particles
DENN/MADD domain containing 1A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146122.2-247s21c1
Sequence:CCGGAGACTACATTTGAAGTGTATGCTCGAGCATACACTTCAAATGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146122.2-951s21c1
Sequence:CCGGTACCTCATAGGAATCCATTTACTCGAGTAAATGGATTCCTATGAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146122.2-3807s21c1
Sequence:CCGGACACCAGCAACTCTAACTTATCTCGAGATAAGTTAGAGTTGCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146122.2-467s21c1
Sequence:CCGGATTCGGGTTCTGCCGCTTATCCTCGAGGATAAGCGGCAGAACCCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146122.2-2104s21c1
Sequence:CCGGTGAAGCTTGCTCATCCATATACTCGAGTATATGGATGAGCAAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146122.2-709s1c1
Sequence:CCGGCCAGCATACCTGAGAATAGAACTCGAGTTCTATTCTCAGGTATGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146122.2-1364s1c1
Sequence:CCGGCGATGTCTTTGAGGAGGAAATCTCGAGATTTCCTCCTCAAAGACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146122.2-662s1c1
Sequence:CCGGCCTCAGTGTGTATTCTTACTTCTCGAGAAGTAAGAATACACACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks