EMAIL THIS PAGE TO A FRIEND

DENND1B

DENN/MADD domain containing 1B

163 Gene Product Result for
Synonyms: C1ORF18 C1orf218 FAM31B
Gene ID:
Human(163486) Summary: Clathrin (see MIM 118955)-mediated endocytosis is a major mechanism for internalization of proteins and lipids. Members of the connecdenn family, such as DENND1B, function as guanine nucleotide exchange factors (GEFs) for the early endosomal small GTPase RAB35 (MIM 604199) and bind to clathrin and clathrin adaptor protein-2 (AP2; see MIM 601024). Thus, connecdenns link RAB35 activation with the clathrin machinery (Marat and McPherson, 2010 [PubMed 20154091]
Mouse(329260) DENN/MADD domain containing 1B
Rat(289051) DENN/MADD domain containing 1B
naked mole-rat(101713291) DENN/MADD domain containing 1B
Zebrafish(560720) DENN/MADD domain containing 1B
chicken(424351) DENN/MADD domain containing 1B
cow(515939) DENN/MADD domain containing 1B
Horse(100061134) DENN/MADD domain containing 1B
domestic cat(101096630) DENN/MADD domain containing 1B
dog(490259) DENN/MADD domain containing 1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183217 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183217 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183217 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144977 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144977 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144977 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU116911 MISSION® esiRNA esiRNA human DENND1B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144977 Rosetta Predictions human pricing
NM_001105954 Rosetta Predictions rat pricing
NM_181347 Rosetta Predictions mouse pricing
NM_183217 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144977 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364778 predicted 645
2 SASI_Hs02_00364779 predicted 698
3 SASI_Hs01_00025508 predicted 1102
4 SASI_Hs01_00025509 predicted 1508
5 SASI_Hs01_00025510 predicted 907
6 SASI_Hs01_00025511 predicted 1476
7 SASI_Hs01_00025512 predicted 428
8 SASI_Hs02_00364780 predicted 813
9 SASI_Hs01_00025513 predicted 1150
10 SASI_Hs01_00025515 predicted 1616
11 SASI_Hs01_00025507 predicted 479
12 SASI_Hs01_00025514 predicted 1435
13 SASI_Hs01_00025516 predicted 571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105954 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214182 predicted 894
2 SASI_Rn02_00214183 predicted 708
3 SASI_Rn02_00214184 predicted 407
4 SASI_Rn02_00214185 predicted 421
5 SASI_Rn02_00214186 predicted 629
6 SASI_Rn02_00214187 predicted 923
7 SASI_Rn02_00214188 predicted 353
8 SASI_Rn02_00214189 predicted 377
9 SASI_Rn02_00214190 predicted 199
10 SASI_Rn02_00214191 predicted 288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181347 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349718 predicted 2314
2 SASI_Mm02_00349719 predicted 1025
3 SASI_Mm02_00349720 predicted 609
4 SASI_Mm02_00349721 predicted 837
5 SASI_Mm02_00349722 predicted 2264
6 SASI_Mm02_00349723 predicted 871
7 SASI_Mm02_00349724 predicted 593
8 SASI_Mm02_00349725 predicted 1084
9 SASI_Mm02_00349726 predicted 327
10 SASI_Mm02_00349727 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183217 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150999 predicted 815
2 SASI_Mm01_00151000 predicted 814
3 SASI_Mm01_00151001 predicted 263
4 SASI_Mm01_00151002 predicted 732
5 SASI_Mm01_00151003 predicted 650
6 SASI_Mm01_00151004 predicted 746
7 SASI_Mm01_00151005 predicted 715
8 SASI_Mm01_00151006 predicted 517
9 SASI_Mm01_00151007 predicted 587
10 SASI_Mm01_00151008 predicted 389
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183217
DENND1B MISSION shRNA Bacterial Glycerol Stock
DENN/MADD domain containing 1B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201069    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183217.1-1125s1c1
Sequence:CCGGCCATGATAATAGCTGCTCCTACTCGAGTAGGAGCAGCTATTATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183217.1-1136s1c1
Sequence:CCGGGCTGCTCCTAACCAGGTAATACTCGAGTATTACCTGGTTAGGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183217.1-751s1c1
Sequence:CCGGGCACTGTAAGTCCTTCACACTCTCGAGAGTGTGAAGGACTTACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183217.1-739s1c1
Sequence:CCGGCGAGCAAATTAAGCACTGTAACTCGAGTTACAGTGCTTAATTTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183217.1-813s1c1
Sequence:CCGGCCTAAACACGTCTGCACATTTCTCGAGAAATGTGCAGACGTGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183217.1-539s1c1
Sequence:CCGGGCTATTTATTGCCAGTGAGCACTCGAGTGCTCACTGGCAATAAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183217.2-482s1c1
Sequence:CCGGCTATAACCACCCAGTACCAAACTCGAGTTTGGTACTGGGTGGTTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183217
DENND1B MISSION shRNA shRNA Plasmid DNA
DENN/MADD domain containing 1B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201069    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183217.1-1125s1c1
Sequence:CCGGCCATGATAATAGCTGCTCCTACTCGAGTAGGAGCAGCTATTATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183217.1-1136s1c1
Sequence:CCGGGCTGCTCCTAACCAGGTAATACTCGAGTATTACCTGGTTAGGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183217.1-751s1c1
Sequence:CCGGGCACTGTAAGTCCTTCACACTCTCGAGAGTGTGAAGGACTTACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183217.1-739s1c1
Sequence:CCGGCGAGCAAATTAAGCACTGTAACTCGAGTTACAGTGCTTAATTTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183217.1-813s1c1
Sequence:CCGGCCTAAACACGTCTGCACATTTCTCGAGAAATGTGCAGACGTGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183217.1-539s1c1
Sequence:CCGGGCTATTTATTGCCAGTGAGCACTCGAGTGCTCACTGGCAATAAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183217.2-482s1c1
Sequence:CCGGCTATAACCACCCAGTACCAAACTCGAGTTTGGTACTGGGTGGTTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183217
DENND1B MISSION shRNA Lentiviral Transduction Particles
DENN/MADD domain containing 1B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201069    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_183217.1-1125s1c1
Sequence:CCGGCCATGATAATAGCTGCTCCTACTCGAGTAGGAGCAGCTATTATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183217.1-1136s1c1
Sequence:CCGGGCTGCTCCTAACCAGGTAATACTCGAGTATTACCTGGTTAGGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183217.1-751s1c1
Sequence:CCGGGCACTGTAAGTCCTTCACACTCTCGAGAGTGTGAAGGACTTACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183217.1-739s1c1
Sequence:CCGGCGAGCAAATTAAGCACTGTAACTCGAGTTACAGTGCTTAATTTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192238    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183217.1-813s1c1
Sequence:CCGGCCTAAACACGTCTGCACATTTCTCGAGAAATGTGCAGACGTGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183217.1-539s1c1
Sequence:CCGGGCTATTTATTGCCAGTGAGCACTCGAGTGCTCACTGGCAATAAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183217.2-482s1c1
Sequence:CCGGCTATAACCACCCAGTACCAAACTCGAGTTTGGTACTGGGTGGTTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144977
VALIDATED
DENND1B MISSION shRNA Bacterial Glycerol Stock
DENN/MADD domain containing 1B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_144977.1-1404s1c1
Sequence:CCGGGAGATCACTTCAGGTGGCTTTCTCGAGAAAGCCACCTGAAGTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127560    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144977.1-1718s1c1
Sequence:CCGGCTTCCTGTCTTTCCTTCTGAACTCGAGTTCAGAAGGAAAGACAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_144977.1-974s1c1
Sequence:CCGGGCCATACCTGATTGGAATACACTCGAGTGTATTCCAATCAGGTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144977.1-1623s1c1
Sequence:CCGGGCATTAAGTTGGCCTCCTGAACTCGAGTTCAGGAGGCCAACTTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128312    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144977.1-1939s1c1
Sequence:CCGGGTTTCCAGTTTACCATTCCATCTCGAGATGGAATGGTAAACTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144977.1-970s1c1
Sequence:CCGGCAATGCCATACCTGATTGGAACTCGAGTTCCAATCAGGTATGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144977.1-681s1c1
Sequence:CCGGCCTGTAAATTTGAGTGTGCATCTCGAGATGCACACTCAAATTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144977
VALIDATED
DENND1B MISSION shRNA shRNA Plasmid DNA
DENN/MADD domain containing 1B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_144977.1-1404s1c1
Sequence:CCGGGAGATCACTTCAGGTGGCTTTCTCGAGAAAGCCACCTGAAGTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127560    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144977.1-1718s1c1
Sequence:CCGGCTTCCTGTCTTTCCTTCTGAACTCGAGTTCAGAAGGAAAGACAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_144977.1-974s1c1
Sequence:CCGGGCCATACCTGATTGGAATACACTCGAGTGTATTCCAATCAGGTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144977.1-1623s1c1
Sequence:CCGGGCATTAAGTTGGCCTCCTGAACTCGAGTTCAGGAGGCCAACTTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128312    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144977.1-1939s1c1
Sequence:CCGGGTTTCCAGTTTACCATTCCATCTCGAGATGGAATGGTAAACTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144977.1-970s1c1
Sequence:CCGGCAATGCCATACCTGATTGGAACTCGAGTTCCAATCAGGTATGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144977.1-681s1c1
Sequence:CCGGCCTGTAAATTTGAGTGTGCATCTCGAGATGCACACTCAAATTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144977
VALIDATED
DENND1B MISSION shRNA Lentiviral Transduction Particles
DENN/MADD domain containing 1B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_144977.1-1404s1c1
Sequence:CCGGGAGATCACTTCAGGTGGCTTTCTCGAGAAAGCCACCTGAAGTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127560    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144977.1-1718s1c1
Sequence:CCGGCTTCCTGTCTTTCCTTCTGAACTCGAGTTCAGAAGGAAAGACAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_144977.1-974s1c1
Sequence:CCGGGCCATACCTGATTGGAATACACTCGAGTGTATTCCAATCAGGTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144977.1-1623s1c1
Sequence:CCGGGCATTAAGTTGGCCTCCTGAACTCGAGTTCAGGAGGCCAACTTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128312    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144977.1-1939s1c1
Sequence:CCGGGTTTCCAGTTTACCATTCCATCTCGAGATGGAATGGTAAACTGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144977.1-970s1c1
Sequence:CCGGCAATGCCATACCTGATTGGAACTCGAGTTCCAATCAGGTATGGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144977.1-681s1c1
Sequence:CCGGCCTGTAAATTTGAGTGTGCATCTCGAGATGCACACTCAAATTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks