EMAIL THIS PAGE TO A FRIEND

DENND1C

DENN/MADD domain containing 1C

55 Gene Product Result for
Synonyms: FAM31C
UniProtKB ID: Q8IV53, B4E051, D3PFD4, Q8NDB1, Q9H5Z2
Gene ID:
Human(79958) Summary: Clathrin (see MIM 118955)-mediated endocytosis is a major mechanism for internalization of proteins and lipids. Members of the connecdenn family, such as DENND1C, function as guanine nucleotide exchange factors (GEFs) for the early endosomal small GTPase RAB35 (MIM 604199) and bind to clathrin and clathrin adaptor protein-2 (AP2; see MIM 601024). Thus, connecdenns link RAB35 activation with the clathrin machinery (Marat and McPherson, 2010 [PubMed 20154091]
Mouse(70785) DENN/MADD domain containing 1C
Rat(363326) DENN/MADD domain containing 1C
dog(485019) DENN/MADD domain containing 1C
Horse(100065730) DENN/MADD domain containing 1C
cow(511230) DENN/MADD domain containing 1C
domestic cat(101096290) DENN/MADD domain containing 1C
sheep(101105327) DENN/MADD domain containing 1C
Domestic Rabbit(100349052) DENN/MADD domain containing 1C
naked mole-rat(101722169) DENN/MADD domain containing 1C
domestic guinea pig(100720914) DENN/MADD domain containing 1C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153551 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153551 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153551 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024898 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024898 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024898 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024898 Rosetta Predictions human pricing
NM_001126289 Rosetta Predictions rat pricing
XM_343664 Rosetta Predictions rat pricing
NM_153551 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176910 predicted 1150
2 SASI_Hs01_00176911 predicted 1769
3 SASI_Hs01_00176912 predicted 1576
4 SASI_Hs01_00176913 predicted 1752
5 SASI_Hs01_00176914 predicted 225
6 SASI_Hs01_00176915 predicted 904
7 SASI_Hs01_00176916 predicted 964
8 SASI_Hs01_00176917 predicted 2474
9 SASI_Hs02_00357495 predicted 941
10 SASI_Hs02_00357496 predicted 2147
11 SASI_Hs01_00176918 predicted 1298
12 SASI_Hs01_00176919 predicted 2460
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126289 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253263 predicted 1576
2 SASI_Rn02_00253264 predicted 940
3 SASI_Rn02_00253265 predicted 485
4 SASI_Rn02_00253266 predicted 790
5 SASI_Rn02_00253267 predicted 699
6 SASI_Rn02_00253268 predicted 1543
7 SASI_Rn02_00253269 predicted 818
8 SASI_Rn02_00253270 predicted 1668
9 SASI_Rn02_00253271 predicted 980
10 SASI_Rn02_00253272 predicted 1010
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343664 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00128502 predicted 703
2 SASI_Rn01_00128503 predicted 232
3 SASI_Rn01_00128504 predicted 698
4 SASI_Rn01_00128505 predicted 662
5 SASI_Rn01_00128506 predicted 312
6 SASI_Rn01_00128507 predicted 442
7 SASI_Rn01_00128508 predicted 679
8 SASI_Rn01_00128509 predicted 472
9 SASI_Rn01_00128510 predicted 576
10 SASI_Rn01_00128511 predicted 572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153551 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343320 predicted 959
2 SASI_Mm02_00343321 predicted 393
3 SASI_Mm02_00343322 predicted 1357
4 SASI_Mm02_00343323 predicted 304
5 SASI_Mm02_00343324 predicted 2247
6 SASI_Mm02_00343325 predicted 413
7 SASI_Mm02_00343326 predicted 1791
8 SASI_Mm02_00343327 predicted 293
9 SASI_Mm02_00343328 predicted 992
10 SASI_Mm02_00343329 predicted 1391
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153551
DENND1C MISSION shRNA Bacterial Glycerol Stock
DENN/MADD domain containing 1C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153551.1-1527s21c1
Sequence:CCGGCAGAACCTGCTCACGATTAAGCTCGAGCTTAATCGTGAGCAGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153551.1-1482s21c1
Sequence:CCGGCAGGAATATTGTGCATCAAAGCTCGAGCTTTGATGCACAATATTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153551.1-330s21c1
Sequence:CCGGCTGGTGGGCAACCGTAGATTTCTCGAGAAATCTACGGTTGCCCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153551.1-2254s21c1
Sequence:CCGGTCCAAAGATTACAATCCATTTCTCGAGAAATGGATTGTAATCTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153551.1-1376s21c1
Sequence:CCGGGCTCTGGGTAGATAGTCTTAACTCGAGTTAAGACTATCTACCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153551
DENND1C MISSION shRNA shRNA Plasmid DNA
DENN/MADD domain containing 1C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153551.1-1527s21c1
Sequence:CCGGCAGAACCTGCTCACGATTAAGCTCGAGCTTAATCGTGAGCAGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153551.1-1482s21c1
Sequence:CCGGCAGGAATATTGTGCATCAAAGCTCGAGCTTTGATGCACAATATTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153551.1-330s21c1
Sequence:CCGGCTGGTGGGCAACCGTAGATTTCTCGAGAAATCTACGGTTGCCCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153551.1-2254s21c1
Sequence:CCGGTCCAAAGATTACAATCCATTTCTCGAGAAATGGATTGTAATCTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153551.1-1376s21c1
Sequence:CCGGGCTCTGGGTAGATAGTCTTAACTCGAGTTAAGACTATCTACCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153551
DENND1C MISSION shRNA Lentiviral Transduction Particles
DENN/MADD domain containing 1C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153551.1-1527s21c1
Sequence:CCGGCAGAACCTGCTCACGATTAAGCTCGAGCTTAATCGTGAGCAGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153551.1-1482s21c1
Sequence:CCGGCAGGAATATTGTGCATCAAAGCTCGAGCTTTGATGCACAATATTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153551.1-330s21c1
Sequence:CCGGCTGGTGGGCAACCGTAGATTTCTCGAGAAATCTACGGTTGCCCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153551.1-2254s21c1
Sequence:CCGGTCCAAAGATTACAATCCATTTCTCGAGAAATGGATTGTAATCTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153551.1-1376s21c1
Sequence:CCGGGCTCTGGGTAGATAGTCTTAACTCGAGTTAAGACTATCTACCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024898
DENND1C MISSION shRNA Bacterial Glycerol Stock
DENN/MADD domain containing 1C
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024898.2-2588s21c1
Sequence:CCGGGCCCTCACTCTGCTCGGAAATCTCGAGATTTCCGAGCAGAGTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024898.2-2479s21c1
Sequence:CCGGAGAAGTGCTTTGAGGGTTAAGCTCGAGCTTAACCCTCAAAGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024898.2-1287s21c1
Sequence:CCGGGAGGGCTTCTCAGATCAATTCCTCGAGGAATTGATCTGAGAAGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024898.2-224s21c1
Sequence:CCGGTATGCAGATGGTGCCTAAATTCTCGAGAATTTAGGCACCATCTGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024898.2-970s21c1
Sequence:CCGGATACCTTGGAGACGACCTTTACTCGAGTAAAGGTCGTCTCCAAGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024898.1-2263s1c1
Sequence:CCGGCCAACTTTGATATAGCCTGGACTCGAGTCCAGGCTATATCAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024898.1-1884s1c1
Sequence:CCGGCCCAACATACTAAGATGGCAACTCGAGTTGCCATCTTAGTATGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024898
DENND1C MISSION shRNA shRNA Plasmid DNA
DENN/MADD domain containing 1C
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024898.2-2588s21c1
Sequence:CCGGGCCCTCACTCTGCTCGGAAATCTCGAGATTTCCGAGCAGAGTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024898.2-2479s21c1
Sequence:CCGGAGAAGTGCTTTGAGGGTTAAGCTCGAGCTTAACCCTCAAAGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024898.2-1287s21c1
Sequence:CCGGGAGGGCTTCTCAGATCAATTCCTCGAGGAATTGATCTGAGAAGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024898.2-224s21c1
Sequence:CCGGTATGCAGATGGTGCCTAAATTCTCGAGAATTTAGGCACCATCTGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024898.2-970s21c1
Sequence:CCGGATACCTTGGAGACGACCTTTACTCGAGTAAAGGTCGTCTCCAAGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024898.1-2263s1c1
Sequence:CCGGCCAACTTTGATATAGCCTGGACTCGAGTCCAGGCTATATCAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024898.1-1884s1c1
Sequence:CCGGCCCAACATACTAAGATGGCAACTCGAGTTGCCATCTTAGTATGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024898
DENND1C MISSION shRNA Lentiviral Transduction Particles
DENN/MADD domain containing 1C
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024898.2-2588s21c1
Sequence:CCGGGCCCTCACTCTGCTCGGAAATCTCGAGATTTCCGAGCAGAGTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024898.2-2479s21c1
Sequence:CCGGAGAAGTGCTTTGAGGGTTAAGCTCGAGCTTAACCCTCAAAGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024898.2-1287s21c1
Sequence:CCGGGAGGGCTTCTCAGATCAATTCCTCGAGGAATTGATCTGAGAAGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024898.2-224s21c1
Sequence:CCGGTATGCAGATGGTGCCTAAATTCTCGAGAATTTAGGCACCATCTGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024898.2-970s21c1
Sequence:CCGGATACCTTGGAGACGACCTTTACTCGAGTAAAGGTCGTCTCCAAGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024898.1-2263s1c1
Sequence:CCGGCCAACTTTGATATAGCCTGGACTCGAGTCCAGGCTATATCAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024898.1-1884s1c1
Sequence:CCGGCCCAACATACTAAGATGGCAACTCGAGTTGCCATCTTAGTATGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks