EMAIL THIS PAGE TO A FRIEND

DENND2A

DENN/MADD domain containing 2A

56 Gene Product Result for
Synonyms: FAM31D KIAA1277
UniProtKB ID: Q9ULE3, C9JUI3, Q1RMD5, Q86XY0
Gene ID:
Mouse(209773) DENN/MADD domain containing 2A
Rat(312257) DENN/MADD domain containing 2A
domestic guinea pig(100718332) DENN/MADD domain containing 2A
naked mole-rat(101709389) DENN/MADD domain containing 2A
sheep(101112131) DENN/MADD domain containing 2A
chicken(418115) DENN/MADD domain containing 2A
cow(512632) DENN/MADD domain containing 2A
domestic cat(101081881) DENN/MADD domain containing 2A
Horse(100065838) DENN/MADD domain containing 2A
dog(482766) DENN/MADD domain containing 2A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172477 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172477 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172477 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015689 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015689 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015689 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015689 Rosetta Predictions human pricing
XM_001070028 Rosetta Predictions rat pricing
XM_231654 Rosetta Predictions rat pricing
NM_172477 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015689 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031898 predicted 3107
2 SASI_Hs01_00031899 predicted 1925
3 SASI_Hs01_00031900 predicted 2180
4 SASI_Hs01_00031902 predicted 1383
5 SASI_Hs01_00031903 predicted 268
6 SASI_Hs01_00031904 predicted 2363
7 SASI_Hs01_00031905 predicted 1657
8 SASI_Hs01_00031906 predicted 682
9 SASI_Hs01_00031907 predicted 1599
10 SASI_Hs02_00348341 predicted 1924
11 SASI_Hs01_00031901 predicted 2300
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070028 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330170 predicted 1985
2 SASI_Rn02_00330171 predicted 1880
3 SASI_Rn02_00330172 predicted 1548
4 SASI_Rn02_00330173 predicted 1743
5 SASI_Rn02_00330174 predicted 2515
6 SASI_Rn02_00330175 predicted 1984
7 SASI_Rn02_00330176 predicted 417
8 SASI_Rn02_00330177 predicted 756
9 SASI_Rn02_00330178 predicted 1801
10 SASI_Rn02_00330179 predicted 2079
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_231654 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386871 predicted 1977
2 SASI_Rn02_00386872 predicted 1882
3 SASI_Rn02_00386873 predicted 1549
4 SASI_Rn02_00386874 predicted 1742
5 SASI_Rn02_00386875 predicted 2512
6 SASI_Rn02_00386876 predicted 1988
7 SASI_Rn02_00386877 predicted 418
8 SASI_Rn02_00386878 predicted 748
9 SASI_Rn02_00386879 predicted 1798
10 SASI_Rn02_00386880 predicted 2083
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172477 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168802 predicted 2150
2 SASI_Mm01_00168803 predicted 2782
3 SASI_Mm01_00168804 predicted 1820
4 SASI_Mm01_00168805 predicted 2252
5 SASI_Mm01_00168806 predicted 2677
6 SASI_Mm01_00168807 predicted 2241
7 SASI_Mm01_00168808 predicted 473
8 SASI_Mm01_00168809 predicted 2587
9 SASI_Mm01_00168810 predicted 483
10 SASI_Mm01_00168811 predicted 2620
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172477
DENND2A MISSION shRNA Bacterial Glycerol Stock
DENN/MADD domain containing 2A
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000195937    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172477.1-3973s1c1
Sequence:CCGGCCAACAAAGCTAGGAGAGGTTCTCGAGAACCTCTCCTAGCTTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172477.1-837s1c1
Sequence:CCGGCCAGCGATCTACGCTTTCAAACTCGAGTTTGAAAGCGTAGATCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172477.1-3334s1c1
Sequence:CCGGCGGAGTCAATAAATTCCTCAACTCGAGTTGAGGAATTTATTGACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172477.1-2351s1c1
Sequence:CCGGCTTCCTGAGGTTTATTGCATTCTCGAGAATGCAATAAACCTCAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172477
DENND2A MISSION shRNA shRNA Plasmid DNA
DENN/MADD domain containing 2A
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000195937    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172477.1-3973s1c1
Sequence:CCGGCCAACAAAGCTAGGAGAGGTTCTCGAGAACCTCTCCTAGCTTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172477.1-837s1c1
Sequence:CCGGCCAGCGATCTACGCTTTCAAACTCGAGTTTGAAAGCGTAGATCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172477.1-3334s1c1
Sequence:CCGGCGGAGTCAATAAATTCCTCAACTCGAGTTGAGGAATTTATTGACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172477.1-2351s1c1
Sequence:CCGGCTTCCTGAGGTTTATTGCATTCTCGAGAATGCAATAAACCTCAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172477
DENND2A MISSION shRNA Lentiviral Transduction Particles
DENN/MADD domain containing 2A
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000195937    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172477.1-3973s1c1
Sequence:CCGGCCAACAAAGCTAGGAGAGGTTCTCGAGAACCTCTCCTAGCTTTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172477.1-837s1c1
Sequence:CCGGCCAGCGATCTACGCTTTCAAACTCGAGTTTGAAAGCGTAGATCGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172477.1-3334s1c1
Sequence:CCGGCGGAGTCAATAAATTCCTCAACTCGAGTTGAGGAATTTATTGACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172477.1-2351s1c1
Sequence:CCGGCTTCCTGAGGTTTATTGCATTCTCGAGAATGCAATAAACCTCAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015689
DENND2A MISSION shRNA Bacterial Glycerol Stock
DENN/MADD domain containing 2A
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000184030    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015689.2-3475s1c1
Sequence:CCGGCCTAGTGCAGCCCTATTCTTTCTCGAGAAAGAATAGGGCTGCACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015689.2-1547s1c1
Sequence:CCGGCCAATGAAGGAGAACCCTTATCTCGAGATAAGGGTTCTCCTTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179932    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015689.2-3476s1c1
Sequence:CCGGCTAGTGCAGCCCTATTCTTTACTCGAGTAAAGAATAGGGCTGCACTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179931    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015689.2-3404s1c1
Sequence:CCGGCTGAAGGGACTAGGCAATAAACTCGAGTTTATTGCCTAGTCCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015689
DENND2A MISSION shRNA shRNA Plasmid DNA
DENN/MADD domain containing 2A
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000184030    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015689.2-3475s1c1
Sequence:CCGGCCTAGTGCAGCCCTATTCTTTCTCGAGAAAGAATAGGGCTGCACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015689.2-1547s1c1
Sequence:CCGGCCAATGAAGGAGAACCCTTATCTCGAGATAAGGGTTCTCCTTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179932    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015689.2-3476s1c1
Sequence:CCGGCTAGTGCAGCCCTATTCTTTACTCGAGTAAAGAATAGGGCTGCACTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179931    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015689.2-3404s1c1
Sequence:CCGGCTGAAGGGACTAGGCAATAAACTCGAGTTTATTGCCTAGTCCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015689
DENND2A MISSION shRNA Lentiviral Transduction Particles
DENN/MADD domain containing 2A
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000184030    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015689.2-3475s1c1
Sequence:CCGGCCTAGTGCAGCCCTATTCTTTCTCGAGAAAGAATAGGGCTGCACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015689.2-1547s1c1
Sequence:CCGGCCAATGAAGGAGAACCCTTATCTCGAGATAAGGGTTCTCCTTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179932    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015689.2-3476s1c1
Sequence:CCGGCTAGTGCAGCCCTATTCTTTACTCGAGTAAAGAATAGGGCTGCACTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179931    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015689.2-3404s1c1
Sequence:CCGGCTGAAGGGACTAGGCAATAAACTCGAGTTTATTGCCTAGTCCCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks