EMAIL THIS PAGE TO A FRIEND

DENND2C

DENN/MADD domain containing 2C

63 Gene Product Result for
Synonyms: dJ1156J9.1
UniProtKB ID: Q68D51, B1AL26, Q5TCX6, Q6P3R3
Gene ID:
Mouse(329727) DENN/MADD domain containing 2C
Rat(295333) DENN/MADD domain containing 2C
Zebrafish(570947) DENN/MADD domain containing 2C
cow(522279) DENN/MADD domain containing 2C
Horse(100059428) DENN/MADD domain containing 2C
domestic cat(101098853) DENN/MADD domain containing 2C
dog(483130) DENN/MADD domain containing 2C
chicken(100858235) DENN/MADD domain containing 2C
sheep(101122903) DENN/MADD domain containing 2C
Domestic Rabbit(100345002) DENN/MADD domain containing 2C
naked mole-rat(101716748) DENN/MADD domain containing 2C
domestic guinea pig(100720576) DENN/MADD domain containing 2C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2103214 Anti-DENND2C antibody produced in rabbit affinity isolated antibody human, canine, rat, rabbit, horse, guinea pig, bovine, mouse
western blot pricing
HPA054955 Anti-DENND2C antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177857 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177857 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177857 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198459 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198459 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198459 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198459 Rosetta Predictions human pricing
XM_001067655 Rosetta Predictions rat pricing
XM_227532 Rosetta Predictions rat pricing
NM_177857 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198459 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371978 predicted 2766
2 SASI_Hs02_00371979 predicted 487
3 SASI_Hs02_00371980 predicted 676
4 SASI_Hs01_00215858 predicted 2587
5 SASI_Hs02_00371981 predicted 1659
6 SASI_Hs01_00215860 predicted 2459
7 SASI_Hs01_00215859 predicted 875
8 SASI_Hs01_00215861 predicted 1720
9 SASI_Hs01_00215864 predicted 1879
10 SASI_Hs02_00371982 predicted 2650
11 SASI_Hs01_00215857 predicted 2444
12 SASI_Hs01_00215862 predicted 1172
13 SASI_Hs01_00215863 predicted 672
14 SASI_Hs01_00215865 predicted 2356
15 SASI_Hs01_00215866 predicted 1507
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067655 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00321722 predicted 2231
2 SASI_Rn02_00321723 predicted 2041
3 SASI_Rn02_00321724 predicted 839
4 SASI_Rn02_00321725 predicted 515
5 SASI_Rn02_00321726 predicted 1226
6 SASI_Rn02_00321727 predicted 1172
7 SASI_Rn02_00321728 predicted 615
8 SASI_Rn02_00321729 predicted 632
9 SASI_Rn02_00321730 predicted 2266
10 SASI_Rn02_00321731 predicted 2299
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227532 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00150868 predicted 235
2 SASI_Rn01_00150869 predicted 382
3 SASI_Rn01_00150870 predicted 1879
4 SASI_Rn01_00150871 predicted 1950
5 SASI_Rn01_00150872 predicted 381
6 SASI_Rn01_00150873 predicted 321
7 SASI_Rn01_00150874 predicted 1819
8 SASI_Rn01_00150875 predicted 1857
9 SASI_Rn01_00150876 predicted 2012
10 SASI_Rn01_00150877 predicted 1896
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177857 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348336 predicted 1532
2 SASI_Mm01_00174040 predicted 949
3 SASI_Mm02_00348337 predicted 394
4 SASI_Mm01_00174041 predicted 926
5 SASI_Mm02_00348338 predicted 1360
6 SASI_Mm01_00174043 predicted 779
7 SASI_Mm01_00174044 predicted 1100
8 SASI_Mm01_00174045 predicted 1285
9 SASI_Mm01_00174046 predicted 1907
10 SASI_Mm01_00174047 predicted 528
11 SASI_Mm01_00174038 predicted 2529
12 SASI_Mm01_00174039 predicted 1358
13 SASI_Mm01_00174042 predicted 1140
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177857
DENND2C MISSION shRNA Bacterial Glycerol Stock
DENN/MADD domain containing 2C
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000200322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177857.1-1345s1c1
Sequence:CCGGGCGGAAGACTATGGAACTGAACTCGAGTTCAGTTCCATAGTCTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177857.1-409s1c1
Sequence:CCGGGACAGCTAAGTTTCACCCAAACTCGAGTTTGGGTGAAACTTAGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177857.1-2440s1c1
Sequence:CCGGGCCAGTGTCCATGATTGACATCTCGAGATGTCAATCATGGACACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177857.1-4056s1c1
Sequence:CCGGGCCAAACACTTGACTTATGAACTCGAGTTCATAAGTCAAGTGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177857
DENND2C MISSION shRNA shRNA Plasmid DNA
DENN/MADD domain containing 2C
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000200322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177857.1-1345s1c1
Sequence:CCGGGCGGAAGACTATGGAACTGAACTCGAGTTCAGTTCCATAGTCTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177857.1-409s1c1
Sequence:CCGGGACAGCTAAGTTTCACCCAAACTCGAGTTTGGGTGAAACTTAGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177857.1-2440s1c1
Sequence:CCGGGCCAGTGTCCATGATTGACATCTCGAGATGTCAATCATGGACACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177857.1-4056s1c1
Sequence:CCGGGCCAAACACTTGACTTATGAACTCGAGTTCATAAGTCAAGTGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177857
DENND2C MISSION shRNA Lentiviral Transduction Particles
DENN/MADD domain containing 2C
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000200322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177857.1-1345s1c1
Sequence:CCGGGCGGAAGACTATGGAACTGAACTCGAGTTCAGTTCCATAGTCTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177857.1-409s1c1
Sequence:CCGGGACAGCTAAGTTTCACCCAAACTCGAGTTTGGGTGAAACTTAGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177857.1-2440s1c1
Sequence:CCGGGCCAGTGTCCATGATTGACATCTCGAGATGTCAATCATGGACACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177857.1-4056s1c1
Sequence:CCGGGCCAAACACTTGACTTATGAACTCGAGTTCATAAGTCAAGTGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198459
VALIDATED
DENND2C MISSION shRNA Bacterial Glycerol Stock
DENN/MADD domain containing 2C
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_198459.2-974s1c1
Sequence:CCGGCGTAGGACATTCAGATATTTACTCGAGTAAATATCTGAATGTCCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167303    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198459.2-3914s1c1
Sequence:CCGGCCAATCCTTAAATCAACCTTACTCGAGTAAGGTTGATTTAAGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167015    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_198459.2-3267s1c1
Sequence:CCGGGCCTTGTTGTTGTTACATTTACTCGAGTAAATGTAACAACAACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198459.2-1670s1c1
Sequence:CCGGCCATCAGGAATAAGCTATATTCTCGAGAATATAGCTTATTCCTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198459.3-1159s21c1
Sequence:CCGGGATATTCAGCACTTTCGAAATCTCGAGATTTCGAAAGTGCTGAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198459.3-875s21c1
Sequence:CCGGTGGATAGTTCATACGGAATAACTCGAGTTATTCCGTATGAACTATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198459.3-2148s21c1
Sequence:CCGGCCGATTGGAACATGTTGATTTCTCGAGAAATCAACATGTTCCAATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198459
VALIDATED
DENND2C MISSION shRNA shRNA Plasmid DNA
DENN/MADD domain containing 2C
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_198459.2-974s1c1
Sequence:CCGGCGTAGGACATTCAGATATTTACTCGAGTAAATATCTGAATGTCCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167303    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198459.2-3914s1c1
Sequence:CCGGCCAATCCTTAAATCAACCTTACTCGAGTAAGGTTGATTTAAGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167015    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_198459.2-3267s1c1
Sequence:CCGGGCCTTGTTGTTGTTACATTTACTCGAGTAAATGTAACAACAACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198459.2-1670s1c1
Sequence:CCGGCCATCAGGAATAAGCTATATTCTCGAGAATATAGCTTATTCCTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198459.3-1159s21c1
Sequence:CCGGGATATTCAGCACTTTCGAAATCTCGAGATTTCGAAAGTGCTGAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198459.3-875s21c1
Sequence:CCGGTGGATAGTTCATACGGAATAACTCGAGTTATTCCGTATGAACTATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198459.3-2148s21c1
Sequence:CCGGCCGATTGGAACATGTTGATTTCTCGAGAAATCAACATGTTCCAATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198459
VALIDATED
DENND2C MISSION shRNA Lentiviral Transduction Particles
DENN/MADD domain containing 2C
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_198459.2-974s1c1
Sequence:CCGGCGTAGGACATTCAGATATTTACTCGAGTAAATATCTGAATGTCCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167303    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198459.2-3914s1c1
Sequence:CCGGCCAATCCTTAAATCAACCTTACTCGAGTAAGGTTGATTTAAGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167015    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_198459.2-3267s1c1
Sequence:CCGGGCCTTGTTGTTGTTACATTTACTCGAGTAAATGTAACAACAACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198459.2-1670s1c1
Sequence:CCGGCCATCAGGAATAAGCTATATTCTCGAGAATATAGCTTATTCCTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198459.3-1159s21c1
Sequence:CCGGGATATTCAGCACTTTCGAAATCTCGAGATTTCGAAAGTGCTGAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198459.3-875s21c1
Sequence:CCGGTGGATAGTTCATACGGAATAACTCGAGTTATTCCGTATGAACTATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198459.3-2148s21c1
Sequence:CCGGCCGATTGGAACATGTTGATTTCTCGAGAAATCAACATGTTCCAATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks