EMAIL THIS PAGE TO A FRIEND

DENND2D

DENN/MADD domain containing 2D

80 Gene Product Result for
UniProtKB ID: Q9H6A0, Q5T5V6, Q9BSU0
Gene ID:
Mouse(72121) DENN/MADD domain containing 2D
Rat(310772) DENN/MADD domain containing 2D
domestic guinea pig(100724063) DENN/MADD domain containing 2D
naked mole-rat(101724799) DENN/MADD domain containing 2D
sheep(101113024) DENN/MADD domain containing 2D
Domestic Rabbit(100353109) DENN/MADD domain containing 2D
chicken(421153) DENN/MADD domain containing 2D
dog(490105) DENN/MADD domain containing 2D
Horse(100058822) DENN/MADD domain containing 2D
cow(504595) DENN/MADD domain containing 2D
domestic cat(101093702) DENN/MADD domain containing 2D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001093754 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001093754 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001093754 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024901 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024901 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024901 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU101891 MISSION® esiRNA esiRNA human DENND2D (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024901 Rosetta Predictions human pricing
NM_001107714 Rosetta Predictions rat pricing
NM_001093754 Rosetta Predictions mouse pricing
NM_028110 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024901 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084254 predicted 1517
2 SASI_Hs01_00084255 predicted 1604
3 SASI_Hs02_00357500 predicted 1107
4 SASI_Hs01_00084256 predicted 1447
5 SASI_Hs01_00084258 predicted 1634
6 SASI_Hs01_00084259 predicted 1364
7 SASI_Hs01_00084260 predicted 412
8 SASI_Hs01_00084261 predicted 1298
9 SASI_Hs01_00084262 predicted 400
10 SASI_Hs02_00357501 predicted 1371
11 SASI_Hs01_00084257 predicted 1585
12 SASI_Hs01_00084263 predicted 1418
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107714 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231545 predicted 666
2 SASI_Rn02_00231546 predicted 1169
3 SASI_Rn02_00231547 predicted 862
4 SASI_Rn02_00231548 predicted 1149
5 SASI_Rn02_00231549 predicted 1053
6 SASI_Rn02_00231550 predicted 1061
7 SASI_Rn02_00231551 predicted 894
8 SASI_Rn02_00231552 predicted 1069
9 SASI_Rn02_00231553 predicted 1176
10 SASI_Rn02_00231554 predicted 1007
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001093754 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301069 predicted 1444
2 SASI_Mm02_00301070 predicted 807
3 SASI_Mm02_00301071 predicted 1691
4 SASI_Mm02_00301072 predicted 1466
5 SASI_Mm02_00301073 predicted 1642
6 SASI_Mm02_00301074 predicted 1655
7 SASI_Mm02_00301075 predicted 652
8 SASI_Mm02_00301076 predicted 702
9 SASI_Mm02_00301077 predicted 1450
10 SASI_Mm02_00301078 predicted 576
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028110 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333355 predicted 1435
2 SASI_Mm01_00068674 predicted 796
3 SASI_Mm02_00333356 predicted 1680
4 SASI_Mm02_00333357 predicted 1453
5 SASI_Mm01_00068677 predicted 1631
6 SASI_Mm01_00068679 predicted 1648
7 SASI_Mm01_00068681 predicted 643
8 SASI_Mm02_00333358 predicted 691
9 SASI_Mm02_00333359 predicted 1429
10 SASI_Mm02_00333360 predicted 565
11 SASI_Mm01_00068675 predicted 1298
12 SASI_Mm01_00068676 predicted 997
13 SASI_Mm01_00068678 predicted 1232
14 SASI_Mm01_00068680 predicted 1183
15 SASI_Mm01_00068682 predicted 1162
16 SASI_Mm01_00068683 predicted 322
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001093754
VALIDATED
DENND2D MISSION shRNA Bacterial Glycerol Stock
DENN/MADD domain containing 2D
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252001    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001093754.1-1895s21c1
Sequence:CCGGAGATAGTAGTACAGGTGTATACTCGAGTATACACCTGTACTACTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001093754.1-1040s21c1
Sequence:CCGGCAGCTCTGCTTTACCCATTTACTCGAGTAAATGGGTAAAGCAGAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093754.1-434s21c1
Sequence:CCGGCCACGATCACTTACCAGTTTCCTCGAGGAAACTGGTAAGTGATCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093754.1-1379s21c1
Sequence:CCGGGCCACTATGCCTCCTATATAACTCGAGTTATATAGGAGGCATAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001093754.1-1408s21c1
Sequence:CCGGGCCAGTGGACAAGGTCATTTCCTCGAGGAAATGACCTTGTCCACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001093754
VALIDATED
DENND2D MISSION shRNA shRNA Plasmid DNA
DENN/MADD domain containing 2D
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252001    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001093754.1-1895s21c1
Sequence:CCGGAGATAGTAGTACAGGTGTATACTCGAGTATACACCTGTACTACTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001093754.1-1040s21c1
Sequence:CCGGCAGCTCTGCTTTACCCATTTACTCGAGTAAATGGGTAAAGCAGAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093754.1-434s21c1
Sequence:CCGGCCACGATCACTTACCAGTTTCCTCGAGGAAACTGGTAAGTGATCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093754.1-1379s21c1
Sequence:CCGGGCCACTATGCCTCCTATATAACTCGAGTTATATAGGAGGCATAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001093754.1-1408s21c1
Sequence:CCGGGCCAGTGGACAAGGTCATTTCCTCGAGGAAATGACCTTGTCCACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001093754
VALIDATED
DENND2D MISSION shRNA Lentiviral Transduction Particles
DENN/MADD domain containing 2D
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252001    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001093754.1-1895s21c1
Sequence:CCGGAGATAGTAGTACAGGTGTATACTCGAGTATACACCTGTACTACTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001093754.1-1040s21c1
Sequence:CCGGCAGCTCTGCTTTACCCATTTACTCGAGTAAATGGGTAAAGCAGAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093754.1-434s21c1
Sequence:CCGGCCACGATCACTTACCAGTTTCCTCGAGGAAACTGGTAAGTGATCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001093754.1-1379s21c1
Sequence:CCGGGCCACTATGCCTCCTATATAACTCGAGTTATATAGGAGGCATAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001093754.1-1408s21c1
Sequence:CCGGGCCAGTGGACAAGGTCATTTCCTCGAGGAAATGACCTTGTCCACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024901
DENND2D MISSION shRNA Bacterial Glycerol Stock
DENN/MADD domain containing 2D
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024901.3-1773s21c1
Sequence:CCGGTTGGATCCCTGGTATTGATTTCTCGAGAAATCAATACCAGGGATCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024901.3-1112s21c1
Sequence:CCGGCTTCATGGTTGGAGTACAAATCTCGAGATTTGTACTCCAACCATGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024901.3-404s21c1
Sequence:CCGGGGATGATTACGAGCCTATAATCTCGAGATTATAGGCTCGTAATCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024901.3-322s21c1
Sequence:CCGGAGCACTCTTTGCCCAACTTTGCTCGAGCAAAGTTGGGCAAAGAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024901.3-1351s21c1
Sequence:CCGGTCAAGATTGTGGGCCATTATGCTCGAGCATAATGGCCCACAATCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024901.3-1302s1c1
Sequence:CCGGGCAGAACAAATCAACGAGCATCTCGAGATGCTCGTTGATTTGTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024901.3-1364s1c1
Sequence:CCGGCCATTATGCTTCCTATATCAACTCGAGTTGATATAGGAAGCATAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024901
DENND2D MISSION shRNA shRNA Plasmid DNA
DENN/MADD domain containing 2D
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024901.3-1773s21c1
Sequence:CCGGTTGGATCCCTGGTATTGATTTCTCGAGAAATCAATACCAGGGATCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024901.3-1112s21c1
Sequence:CCGGCTTCATGGTTGGAGTACAAATCTCGAGATTTGTACTCCAACCATGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024901.3-404s21c1
Sequence:CCGGGGATGATTACGAGCCTATAATCTCGAGATTATAGGCTCGTAATCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024901.3-322s21c1
Sequence:CCGGAGCACTCTTTGCCCAACTTTGCTCGAGCAAAGTTGGGCAAAGAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024901.3-1351s21c1
Sequence:CCGGTCAAGATTGTGGGCCATTATGCTCGAGCATAATGGCCCACAATCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024901.3-1302s1c1
Sequence:CCGGGCAGAACAAATCAACGAGCATCTCGAGATGCTCGTTGATTTGTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024901.3-1364s1c1
Sequence:CCGGCCATTATGCTTCCTATATCAACTCGAGTTGATATAGGAAGCATAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024901
DENND2D MISSION shRNA Lentiviral Transduction Particles
DENN/MADD domain containing 2D
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024901.3-1773s21c1
Sequence:CCGGTTGGATCCCTGGTATTGATTTCTCGAGAAATCAATACCAGGGATCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024901.3-1112s21c1
Sequence:CCGGCTTCATGGTTGGAGTACAAATCTCGAGATTTGTACTCCAACCATGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024901.3-404s21c1
Sequence:CCGGGGATGATTACGAGCCTATAATCTCGAGATTATAGGCTCGTAATCATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024901.3-322s21c1
Sequence:CCGGAGCACTCTTTGCCCAACTTTGCTCGAGCAAAGTTGGGCAAAGAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024901.3-1351s21c1
Sequence:CCGGTCAAGATTGTGGGCCATTATGCTCGAGCATAATGGCCCACAATCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024901.3-1302s1c1
Sequence:CCGGGCAGAACAAATCAACGAGCATCTCGAGATGCTCGTTGATTTGTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024901.3-1364s1c1
Sequence:CCGGCCATTATGCTTCCTATATCAACTCGAGTTGATATAGGAAGCATAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)