EMAIL THIS PAGE TO A FRIEND

DENND3

DENN/MADD domain containing 3

73 Gene Product Result for
UniProtKB ID: A2RUS2, B7ZM28, O94947, Q2TAM7, Q6ZMS6, Q96DK3
Gene ID:
Mouse(105841) DENN/MADD domain containing 3
Rat(315055) DENN/MADD domain containing 3
chicken(420309) DENN/MADD domain containing 3
cow(508078) DENN/MADD domain containing 3
Horse(100069608) DENN/MADD domain containing 3
domestic cat(101085182) DENN/MADD domain containing 3
dog(100688774) DENN/MADD domain containing 3
sheep(101118882) DENN/MADD domain containing 3
naked mole-rat(101709911) DENN/MADD domain containing 3
domestic guinea pig(100725401) DENN/MADD domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014957 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014957 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014957 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081066 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081066 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081066 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014957 Rosetta Predictions human pricing
XM_001072997 Rosetta Predictions rat pricing
XM_235398 Rosetta Predictions rat pricing
NM_001081066 Rosetta Predictions mouse pricing
XM_128129 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014957 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346637 predicted 3055
2 SASI_Hs01_00134890 predicted 1486
3 SASI_Hs01_00134891 predicted 2605
4 SASI_Hs01_00134892 predicted 1103
5 SASI_Hs01_00134893 predicted 3848
6 SASI_Hs02_00346638 predicted 1581
7 SASI_Hs02_00346639 predicted 2321
8 SASI_Hs01_00134895 predicted 3723
9 SASI_Hs01_00134896 predicted 534
10 SASI_Hs01_00134897 predicted 1220
11 SASI_Hs01_00134889 predicted 2989
12 SASI_Hs01_00134894 predicted 2490
13 SASI_Hs01_00134898 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072997 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00341219 predicted 2912
2 SASI_Rn02_00341220 predicted 2806
3 SASI_Rn02_00341221 predicted 2382
4 SASI_Rn02_00341222 predicted 2839
5 SASI_Rn02_00341223 predicted 1382
6 SASI_Rn02_00341224 predicted 1120
7 SASI_Rn02_00341225 predicted 3469
8 SASI_Rn02_00341226 predicted 2563
9 SASI_Rn02_00341227 predicted 2676
10 SASI_Rn02_00341228 predicted 1606
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235398 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389248 predicted 2915
2 SASI_Rn02_00389249 predicted 2804
3 SASI_Rn02_00389250 predicted 2374
4 SASI_Rn02_00389251 predicted 2834
5 SASI_Rn02_00389252 predicted 1385
6 SASI_Rn02_00389253 predicted 1121
7 SASI_Rn02_00389254 predicted 3467
8 SASI_Rn02_00389255 predicted 2562
9 SASI_Rn02_00389256 predicted 2675
10 SASI_Rn02_00389257 predicted 1609
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081066 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294841 predicted 2372
2 SASI_Mm02_00294842 predicted 2008
3 SASI_Mm02_00294843 predicted 2361
4 SASI_Mm02_00294844 predicted 1181
5 SASI_Mm02_00294845 predicted 3979
6 SASI_Mm02_00294846 predicted 921
7 SASI_Mm02_00294847 predicted 2363
8 SASI_Mm02_00294848 predicted 1904
9 SASI_Mm02_00294849 predicted 2926
10 SASI_Mm02_00294850 predicted 1257
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_128129 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00218907 predicted 2379
2 SASI_Mm01_00218908 predicted 2019
3 SASI_Mm01_00218909 predicted 2367
4 SASI_Mm01_00218910 predicted 1190
5 SASI_Mm01_00218911 predicted 1553
6 SASI_Mm01_00218912 predicted 3985
7 SASI_Mm01_00218913 predicted 925
8 SASI_Mm01_00218914 predicted 1962
9 SASI_Mm01_00218915 predicted 2375
10 SASI_Mm01_00218916 predicted 1911
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014957
DENND3 MISSION shRNA Bacterial Glycerol Stock
DENN/MADD domain containing 3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014957.2-723s1c1
Sequence:CCGGGCTGCGAAGCTGTCTTTAATACTCGAGTATTAAAGACAGCTTCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014957.2-2463s1c1
Sequence:CCGGGTCAAGACAAACCTAGGCGTTCTCGAGAACGCCTAGGTTTGTCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014957.2-1217s1c1
Sequence:CCGGCCAGACGTTTATTCAGAGGGTCTCGAGACCCTCTGAATAAACGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014957.2-3236s1c1
Sequence:CCGGCTCCAGTGTCACGGATTTGATCTCGAGATCAAATCCGTGACACTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014957.2-4118s1c1
Sequence:CCGGGCTGCGTCTTGTTGGTGATAACTCGAGTTATCACCAACAAGACGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140036    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014957.2-5222s1c1
Sequence:CCGGGCAGAGAGAATTATGTGGCCTCTCGAGAGGCCACATAATTCTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014957.2-2579s1c1
Sequence:CCGGCAGGAGAACCACTACTACATTCTCGAGAATGTAGTAGTGGTTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014957.2-439s1c1
Sequence:CCGGCCACTGAACCTAAGGAGGATTCTCGAGAATCCTCCTTAGGTTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014957.2-760s21c1
Sequence:CCGGGACCGCTCCATTTGGTATTTACTCGAGTAAATACCAAATGGAGCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014957.2-1107s21c1
Sequence:CCGGAGCAAGGAAGCCGACGGTTTACTCGAGTAAACCGTCGGCTTCCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014957.2-1828s21c1
Sequence:CCGGAGATTCCCGAAATCCACTTTCCTCGAGGAAAGTGGATTTCGGGAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014957.2-2828s21c1
Sequence:CCGGCTACGCTGCCTCCAAGTTATCCTCGAGGATAACTTGGAGGCAGCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014957
DENND3 MISSION shRNA shRNA Plasmid DNA
DENN/MADD domain containing 3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014957.2-723s1c1
Sequence:CCGGGCTGCGAAGCTGTCTTTAATACTCGAGTATTAAAGACAGCTTCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014957.2-2463s1c1
Sequence:CCGGGTCAAGACAAACCTAGGCGTTCTCGAGAACGCCTAGGTTTGTCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014957.2-1217s1c1
Sequence:CCGGCCAGACGTTTATTCAGAGGGTCTCGAGACCCTCTGAATAAACGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014957.2-3236s1c1
Sequence:CCGGCTCCAGTGTCACGGATTTGATCTCGAGATCAAATCCGTGACACTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014957.2-4118s1c1
Sequence:CCGGGCTGCGTCTTGTTGGTGATAACTCGAGTTATCACCAACAAGACGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140036    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014957.2-5222s1c1
Sequence:CCGGGCAGAGAGAATTATGTGGCCTCTCGAGAGGCCACATAATTCTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014957.2-2579s1c1
Sequence:CCGGCAGGAGAACCACTACTACATTCTCGAGAATGTAGTAGTGGTTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014957.2-439s1c1
Sequence:CCGGCCACTGAACCTAAGGAGGATTCTCGAGAATCCTCCTTAGGTTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014957.2-760s21c1
Sequence:CCGGGACCGCTCCATTTGGTATTTACTCGAGTAAATACCAAATGGAGCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014957.2-1107s21c1
Sequence:CCGGAGCAAGGAAGCCGACGGTTTACTCGAGTAAACCGTCGGCTTCCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014957.2-1828s21c1
Sequence:CCGGAGATTCCCGAAATCCACTTTCCTCGAGGAAAGTGGATTTCGGGAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014957.2-2828s21c1
Sequence:CCGGCTACGCTGCCTCCAAGTTATCCTCGAGGATAACTTGGAGGCAGCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014957
DENND3 MISSION shRNA Lentiviral Transduction Particles
DENN/MADD domain containing 3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014957.2-723s1c1
Sequence:CCGGGCTGCGAAGCTGTCTTTAATACTCGAGTATTAAAGACAGCTTCGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014957.2-2463s1c1
Sequence:CCGGGTCAAGACAAACCTAGGCGTTCTCGAGAACGCCTAGGTTTGTCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014957.2-1217s1c1
Sequence:CCGGCCAGACGTTTATTCAGAGGGTCTCGAGACCCTCTGAATAAACGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014957.2-3236s1c1
Sequence:CCGGCTCCAGTGTCACGGATTTGATCTCGAGATCAAATCCGTGACACTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014957.2-4118s1c1
Sequence:CCGGGCTGCGTCTTGTTGGTGATAACTCGAGTTATCACCAACAAGACGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140036    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014957.2-5222s1c1
Sequence:CCGGGCAGAGAGAATTATGTGGCCTCTCGAGAGGCCACATAATTCTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014957.2-2579s1c1
Sequence:CCGGCAGGAGAACCACTACTACATTCTCGAGAATGTAGTAGTGGTTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014957.2-439s1c1
Sequence:CCGGCCACTGAACCTAAGGAGGATTCTCGAGAATCCTCCTTAGGTTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014957.2-760s21c1
Sequence:CCGGGACCGCTCCATTTGGTATTTACTCGAGTAAATACCAAATGGAGCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014957.2-1107s21c1
Sequence:CCGGAGCAAGGAAGCCGACGGTTTACTCGAGTAAACCGTCGGCTTCCTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014957.2-1828s21c1
Sequence:CCGGAGATTCCCGAAATCCACTTTCCTCGAGGAAAGTGGATTTCGGGAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014957.2-2828s21c1
Sequence:CCGGCTACGCTGCCTCCAAGTTATCCTCGAGGATAACTTGGAGGCAGCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081066
VALIDATED
DENND3 MISSION shRNA Bacterial Glycerol Stock
DENN/MADD domain containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081066.1-1893s21c1
Sequence:CCGGGAACTCATCGCTTCGGATAATCTCGAGATTATCCGAAGCGATGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081066.1-914s21c1
Sequence:CCGGGGCCGCTCCACTTGATATTTACTCGAGTAAATATCAAGTGGAGCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081066.1-4166s21c1
Sequence:CCGGCTGTAAAGTTACCTCATATTACTCGAGTAATATGAGGTAACTTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081066.1-2177s21c1
Sequence:CCGGACCTGTATAAGACCGACATAGCTCGAGCTATGTCGGTCTTATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081066.1-2417s21c1
Sequence:CCGGTCGTGAAGGACGCCGTCATTACTCGAGTAATGACGGCGTCCTTCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081066
VALIDATED
DENND3 MISSION shRNA shRNA Plasmid DNA
DENN/MADD domain containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081066.1-1893s21c1
Sequence:CCGGGAACTCATCGCTTCGGATAATCTCGAGATTATCCGAAGCGATGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081066.1-914s21c1
Sequence:CCGGGGCCGCTCCACTTGATATTTACTCGAGTAAATATCAAGTGGAGCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081066.1-4166s21c1
Sequence:CCGGCTGTAAAGTTACCTCATATTACTCGAGTAATATGAGGTAACTTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081066.1-2177s21c1
Sequence:CCGGACCTGTATAAGACCGACATAGCTCGAGCTATGTCGGTCTTATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081066.1-2417s21c1
Sequence:CCGGTCGTGAAGGACGCCGTCATTACTCGAGTAATGACGGCGTCCTTCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081066
VALIDATED
DENND3 MISSION shRNA Lentiviral Transduction Particles
DENN/MADD domain containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081066.1-1893s21c1
Sequence:CCGGGAACTCATCGCTTCGGATAATCTCGAGATTATCCGAAGCGATGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081066.1-914s21c1
Sequence:CCGGGGCCGCTCCACTTGATATTTACTCGAGTAAATATCAAGTGGAGCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081066.1-4166s21c1
Sequence:CCGGCTGTAAAGTTACCTCATATTACTCGAGTAATATGAGGTAACTTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081066.1-2177s21c1
Sequence:CCGGACCTGTATAAGACCGACATAGCTCGAGCTATGTCGGTCTTATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081066.1-2417s21c1
Sequence:CCGGTCGTGAAGGACGCCGTCATTACTCGAGTAATGACGGCGTCCTTCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks