EMAIL THIS PAGE TO A FRIEND

DENND4B

DENN/MADD domain containing 4B

Synonyms: KIAA0476
UniProtKB ID: O75064, Q5T4K0
Gene ID:
Mouse(229541) DENN/MADD domain containing 4B
Rat(361987) DENN/MADD domain containing 4B
sheep(101107240) DENN/MADD domain containing 4B
Domestic Rabbit(100338329) DENN/MADD domain containing 4B
naked mole-rat(101709862) DENN/MADD domain containing 4B
domestic guinea pig(100727143) DENN/MADD domain containing 4B
dog(480138) DENN/MADD domain containing 4B
domestic cat(101086946) DENN/MADD domain containing 4B
cow(508196) DENN/MADD domain containing 4B
Horse(100062197) DENN/MADD domain containing 4B
116 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_201407 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201407 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201407 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014856 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014856 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014856 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014856 Rosetta Predictions human pricing
XM_375806 Rosetta Predictions human pricing
XM_934790 Rosetta Predictions human pricing
XM_934791 Rosetta Predictions human pricing
XM_934792 Rosetta Predictions human pricing
XM_934793 Rosetta Predictions human pricing
XM_934794 Rosetta Predictions human pricing
XM_342287 Rosetta Predictions rat pricing
XR_008998 Rosetta Predictions rat pricing
NM_201407 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014856 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346425 predicted 979
2 SASI_Hs02_00346426 predicted 4676
3 SASI_Hs02_00346427 predicted 3883
4 SASI_Hs02_00346428 predicted 2425
5 SASI_Hs02_00346429 predicted 2500
6 SASI_Hs02_00346430 predicted 2835
7 SASI_Hs02_00346431 predicted 1525
8 SASI_Hs02_00346432 predicted 1252
9 SASI_Hs02_00346433 predicted 4599
10 SASI_Hs02_00346434 predicted 828
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_375806 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00263970 predicted 4359
2 SASI_Hs01_00263971 predicted 3563
3 SASI_Hs01_00263972 predicted 3619
4 SASI_Hs01_00263973 predicted 2102
5 SASI_Hs01_00263974 predicted 2179
6 SASI_Hs01_00263975 predicted 3712
7 SASI_Hs01_00263976 predicted 2519
8 SASI_Hs01_00263977 predicted 1209
9 SASI_Hs01_00263978 predicted 940
10 SASI_Hs01_00263979 predicted 4277
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934790 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00287525 predicted 1137
2 SASI_Hs01_00287526 predicted 705
3 SASI_Hs01_00287527 predicted 1103
4 SASI_Hs01_00287528 predicted 416
5 SASI_Hs01_00287529 predicted 752
6 SASI_Hs01_00287530 predicted 791
7 SASI_Hs01_00287531 predicted 958
8 SASI_Hs01_00287532 predicted 785
9 SASI_Hs01_00287533 predicted 738
10 SASI_Hs01_00287534 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934791 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00261797 predicted 1157
2 SASI_Hs01_00261798 predicted 3569
3 SASI_Hs01_00261799 predicted 2776
4 SASI_Hs01_00261800 predicted 695
5 SASI_Hs01_00261801 predicted 2824
6 SASI_Hs01_00261802 predicted 1310
7 SASI_Hs01_00261803 predicted 1393
8 SASI_Hs01_00261804 predicted 2924
9 SASI_Hs01_00261805 predicted 3221
10 SASI_Hs01_00261806 predicted 1723
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934792 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00267229 predicted 729
2 SASI_Hs01_00267230 predicted 718
3 SASI_Hs01_00267231 predicted 538
4 SASI_Hs01_00267232 predicted 729
5 SASI_Hs01_00267233 predicted 511
6 SASI_Hs01_00267234 predicted 664
7 SASI_Hs01_00267235 predicted 526
8 SASI_Hs01_00267236 predicted 681
9 SASI_Hs01_00267237 predicted 871
10 SASI_Hs01_00267238 predicted 829
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934793 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00248191 predicted 959
2 SASI_Hs01_00248192 predicted 956
3 SASI_Hs01_00248193 predicted 775
4 SASI_Hs01_00248194 predicted 963
5 SASI_Hs01_00248195 predicted 752
6 SASI_Hs01_00248196 predicted 901
7 SASI_Hs01_00248197 predicted 767
8 SASI_Hs01_00248198 predicted 914
9 SASI_Hs01_00248199 predicted 1115
10 SASI_Hs01_00248200 predicted 1066
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934794 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00260477 predicted 3268
2 SASI_Hs01_00260478 predicted 4362
3 SASI_Hs01_00260479 predicted 4117
4 SASI_Hs01_00260480 predicted 3179
5 SASI_Hs01_00260481 predicted 4172
6 SASI_Hs01_00260482 predicted 3361
7 SASI_Hs01_00260483 predicted 3216
8 SASI_Hs01_00260484 predicted 4150
9 SASI_Hs01_00260485 predicted 4310
10 SASI_Hs01_00260486 predicted 3360
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342287 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394047 predicted 1910
2 SASI_Rn02_00394048 predicted 4283
3 SASI_Rn02_00394049 predicted 1386
4 SASI_Rn02_00394050 predicted 2254
5 SASI_Rn02_00394051 predicted 3650
6 SASI_Rn02_00394052 predicted 3564
7 SASI_Rn02_00394053 predicted 2065
8 SASI_Rn02_00394054 predicted 918
9 SASI_Rn02_00394055 predicted 509
10 SASI_Rn02_00394056 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008998 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00190623 predicted 1917
2 SASI_Rn01_00190624 predicted 4140
3 SASI_Rn02_00418446 predicted 2249
4 SASI_Rn01_00190626 predicted 4968
5 SASI_Rn01_00190628 predicted 3504
6 SASI_Rn01_00190629 predicted 3413
7 SASI_Rn01_00190630 predicted 2071
8 SASI_Rn01_00190631 predicted 926
9 SASI_Rn01_00190632 predicted 514
10 SASI_Rn02_00418447 predicted 606
11 SASI_Rn01_00190625 predicted 2277
12 SASI_Rn01_00190627 predicted 3918
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201407 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025787 predicted 2232
2 SASI_Mm01_00025788 predicted 4315
3 SASI_Mm01_00025789 predicted 1555
4 SASI_Mm01_00025790 predicted 3633
5 SASI_Mm02_00351580 predicted 286
6 SASI_Mm02_00351581 predicted 732
7 SASI_Mm02_00351582 predicted 532
8 SASI_Mm02_00351583 predicted 902
9 SASI_Mm01_00025793 predicted 2029
10 SASI_Mm01_00025794 predicted 1371
11 SASI_Mm01_00025791 predicted 3911
12 SASI_Mm01_00025792 predicted 1888
13 SASI_Mm01_00025795 predicted 1882
14 SASI_Mm01_00025796 predicted 1909
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201407
DENND4B MISSION shRNA Bacterial Glycerol Stock
DENN/MADD domain containing 4B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201407.1-3288s1c1
Sequence:CCGGCCTTAATACAACTTGTCCCTTCTCGAGAAGGGACAAGTTGTATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201407.1-2322s1c1
Sequence:CCGGCACCATCACTTACGGTTACTACTCGAGTAGTAACCGTAAGTGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201407.1-3957s1c1
Sequence:CCGGCGGACTCAACGAGGTTCATAACTCGAGTTATGAACCTCGTTGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201407.1-3912s1c1
Sequence:CCGGCTCATGTCTTAGCTTGGCATTCTCGAGAATGCCAAGCTAAGACATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201407.1-2093s1c1
Sequence:CCGGGCTACGGACTGTGGTTCTTATCTCGAGATAAGAACCACAGTCCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201407.3-4450s21c1
Sequence:CCGGATCTACCGTGAGATCTTATTCCTCGAGGAATAAGATCTCACGGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201407.3-4885s21c1
Sequence:CCGGGTTGACACAACTCCGTCTTTCCTCGAGGAAAGACGGAGTTGTGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201407.3-3682s21c1
Sequence:CCGGCCGGATGACTCTAACCTTAATCTCGAGATTAAGGTTAGAGTCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201407.3-2697s21c1
Sequence:CCGGCACCATCACTTACGGTTACTACTCGAGTAGTAACCGTAAGTGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201407.3-176s21c1
Sequence:CCGGCCCGGTTGGTGGATTACTTTGCTCGAGCAAAGTAATCCACCAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201407
DENND4B MISSION shRNA shRNA Plasmid DNA
DENN/MADD domain containing 4B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201407.1-3288s1c1
Sequence:CCGGCCTTAATACAACTTGTCCCTTCTCGAGAAGGGACAAGTTGTATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201407.1-2322s1c1
Sequence:CCGGCACCATCACTTACGGTTACTACTCGAGTAGTAACCGTAAGTGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201407.1-3957s1c1
Sequence:CCGGCGGACTCAACGAGGTTCATAACTCGAGTTATGAACCTCGTTGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201407.1-3912s1c1
Sequence:CCGGCTCATGTCTTAGCTTGGCATTCTCGAGAATGCCAAGCTAAGACATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201407.1-2093s1c1
Sequence:CCGGGCTACGGACTGTGGTTCTTATCTCGAGATAAGAACCACAGTCCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201407.3-4450s21c1
Sequence:CCGGATCTACCGTGAGATCTTATTCCTCGAGGAATAAGATCTCACGGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201407.3-4885s21c1
Sequence:CCGGGTTGACACAACTCCGTCTTTCCTCGAGGAAAGACGGAGTTGTGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201407.3-3682s21c1
Sequence:CCGGCCGGATGACTCTAACCTTAATCTCGAGATTAAGGTTAGAGTCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201407.3-2697s21c1
Sequence:CCGGCACCATCACTTACGGTTACTACTCGAGTAGTAACCGTAAGTGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201407.3-176s21c1
Sequence:CCGGCCCGGTTGGTGGATTACTTTGCTCGAGCAAAGTAATCCACCAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201407
DENND4B MISSION shRNA Lentiviral Transduction Particles
DENN/MADD domain containing 4B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201407.1-3288s1c1
Sequence:CCGGCCTTAATACAACTTGTCCCTTCTCGAGAAGGGACAAGTTGTATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201407.1-2322s1c1
Sequence:CCGGCACCATCACTTACGGTTACTACTCGAGTAGTAACCGTAAGTGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201407.1-3957s1c1
Sequence:CCGGCGGACTCAACGAGGTTCATAACTCGAGTTATGAACCTCGTTGAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201407.1-3912s1c1
Sequence:CCGGCTCATGTCTTAGCTTGGCATTCTCGAGAATGCCAAGCTAAGACATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201407.1-2093s1c1
Sequence:CCGGGCTACGGACTGTGGTTCTTATCTCGAGATAAGAACCACAGTCCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201407.3-4450s21c1
Sequence:CCGGATCTACCGTGAGATCTTATTCCTCGAGGAATAAGATCTCACGGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201407.3-4885s21c1
Sequence:CCGGGTTGACACAACTCCGTCTTTCCTCGAGGAAAGACGGAGTTGTGTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201407.3-3682s21c1
Sequence:CCGGCCGGATGACTCTAACCTTAATCTCGAGATTAAGGTTAGAGTCATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201407.3-2697s21c1
Sequence:CCGGCACCATCACTTACGGTTACTACTCGAGTAGTAACCGTAAGTGATGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201407.3-176s21c1
Sequence:CCGGCCCGGTTGGTGGATTACTTTGCTCGAGCAAAGTAATCCACCAACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014856
VALIDATED
DENND4B MISSION shRNA Bacterial Glycerol Stock
DENN/MADD domain containing 4B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014856.2-5287s21c1
Sequence:CCGGATGTCATTCTCCACCAATAATCTCGAGATTATTGGTGGAGAATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014856.2-2948s21c1
Sequence:CCGGCACCTATGGCTACTACAATAACTCGAGTTATTGTAGTAGCCATAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_014856.2-4683s21c1
Sequence:CCGGGGAATCTACCGTGAGATATTACTCGAGTAATATCTCACGGTAGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_014856.2-4739s21c1
Sequence:CCGGGGACATAGTGGCCTTCGATAACTCGAGTTATCGAAGGCCACTATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_014856.2-918s21c1
Sequence:CCGGGAGGGCACTCCTCATACTTACCTCGAGGTAAGTATGAGGAGTGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014856
VALIDATED
DENND4B MISSION shRNA shRNA Plasmid DNA
DENN/MADD domain containing 4B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014856.2-5287s21c1
Sequence:CCGGATGTCATTCTCCACCAATAATCTCGAGATTATTGGTGGAGAATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014856.2-2948s21c1
Sequence:CCGGCACCTATGGCTACTACAATAACTCGAGTTATTGTAGTAGCCATAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_014856.2-4683s21c1
Sequence:CCGGGGAATCTACCGTGAGATATTACTCGAGTAATATCTCACGGTAGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_014856.2-4739s21c1
Sequence:CCGGGGACATAGTGGCCTTCGATAACTCGAGTTATCGAAGGCCACTATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_014856.2-918s21c1
Sequence:CCGGGAGGGCACTCCTCATACTTACCTCGAGGTAAGTATGAGGAGTGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014856
VALIDATED
DENND4B MISSION shRNA Lentiviral Transduction Particles
DENN/MADD domain containing 4B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344361    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014856.2-5287s21c1
Sequence:CCGGATGTCATTCTCCACCAATAATCTCGAGATTATTGGTGGAGAATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014856.2-2948s21c1
Sequence:CCGGCACCTATGGCTACTACAATAACTCGAGTTATTGTAGTAGCCATAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_014856.2-4683s21c1
Sequence:CCGGGGAATCTACCGTGAGATATTACTCGAGTAATATCTCACGGTAGATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_014856.2-4739s21c1
Sequence:CCGGGGACATAGTGGCCTTCGATAACTCGAGTTATCGAAGGCCACTATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_014856.2-918s21c1
Sequence:CCGGGAGGGCACTCCTCATACTTACCTCGAGGTAAGTATGAGGAGTGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks